MZF1 cdna clone
MZF1 cDNA Clone
Gene Names
MZF1; MZF-1; MZF1B; ZFP98; ZNF42; ZSCAN6
Synonyms
MZF1; MZF1 cDNA Clone; MZF1 cdna clone
Sequence
atgaggcctgcggtgctgggctccccagaccgagcacccccagaagatgaggggcctgtcatggtgaagctagaggactctgaggaggagggtgaggctgccttatgggacccaggccctgaagctgcacgcctgcgtttccggtgcttccactatgaggaggccacagggccccaagaggccctggcccagctccgagagctgtgtcgccagtggctgcgtccagaggtacgctccaaggagcagatgctggagctgttggtgctggagcagttcctgggcgcactgccccctgagatccaggcccgtgtgcaggggcagcggccaggcagccccgaggaggctgctgccctagtagatgggctgcgccgggagccgggcggaccccggagatgggtcacagtccaggtgcagggccaggaggtcctatcagagaagatggagccctccagtttccagcccctacctgaaactgagcctccaactccagagcctgggcccaagacacctcctaggactatgcaggaatcaccactgggcctgcaggtgaaagaggagtcagaggttacagaggactcagatttcctggagtctgggcctctagctgccacccaggagtctgtacccaccctcctgcctgaggaggcccagagatgtgggaccgtgctggaccagatctttccccacagcaagactgggcctgagggtccctcatggagggagcaccccagggccctgtggcatgaggaagctgggggcatcttctccccaggggccggagccggggccgccccagcactgggggcggggtggttaggggcggccgttgcgatgtatgtggcaaggtgttcagccaacgcagcaacctgctga
Sequence Length
873
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
31,460 Da
NCBI Official Full Name
Homo sapiens myeloid zinc finger 1, mRNA
NCBI Official Synonym Full Names
myeloid zinc finger 1
NCBI Official Symbol
MZF1
NCBI Official Synonym Symbols
MZF-1; MZF1B; ZFP98; ZNF42; ZSCAN6
NCBI Protein Information
myeloid zinc finger 1
UniProt Protein Name
Myeloid zinc finger 1
Protein Family
UniProt Gene Name
MZF1
UniProt Synonym Gene Names
MZF; ZNF42; ZSCAN6; MZF-1
UniProt Entry Name
MZF1_HUMAN
Uniprot Description
MZF-1: Binds to target promoter DNA and functions as trancription regulator. Regulates transcription from the PADI1 and CDH2 promoter. May be one regulator of transcriptional events during hemopoietic development. Belongs to the krueppel C2H2-type zinc-finger protein family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: DNA-binding; C2H2-type zinc finger protein; Transcription factor
Chromosomal Location of Human Ortholog: 19q13.4
Cellular Component: nucleus
Molecular Function: protein binding; protein homodimerization activity
Biological Process: negative regulation of transcription from RNA polymerase II promoter; positive regulation of transcription from RNA polymerase II promoter; regulation of transcription, DNA-dependent
Research Articles on MZF1
Similar Products
Product Notes
The MZF1 mzf1 (Catalog #AAA1272895) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaggcctg cggtgctggg ctccccagac cgagcacccc cagaagatga ggggcctgtc atggtgaagc tagaggactc tgaggaggag ggtgaggctg ccttatggga cccaggccct gaagctgcac gcctgcgttt ccggtgcttc cactatgagg aggccacagg gccccaagag gccctggccc agctccgaga gctgtgtcgc cagtggctgc gtccagaggt acgctccaag gagcagatgc tggagctgtt ggtgctggag cagttcctgg gcgcactgcc ccctgagatc caggcccgtg tgcaggggca gcggccaggc agccccgagg aggctgctgc cctagtagat gggctgcgcc gggagccggg cggaccccgg agatgggtca cagtccaggt gcagggccag gaggtcctat cagagaagat ggagccctcc agtttccagc ccctacctga aactgagcct ccaactccag agcctgggcc caagacacct cctaggacta tgcaggaatc accactgggc ctgcaggtga aagaggagtc agaggttaca gaggactcag atttcctgga gtctgggcct ctagctgcca cccaggagtc tgtacccacc ctcctgcctg aggaggccca gagatgtggg accgtgctgg accagatctt tccccacagc aagactgggc ctgagggtcc ctcatggagg gagcacccca gggccctgtg gcatgaggaa gctgggggca tcttctcccc aggggccgga gccggggccg ccccagcact gggggcgggg tggttagggg cggccgttgc gatgtatgtg gcaaggtgtt cagccaacgc agcaacctgc tga. It is sometimes possible for the material contained within the vial of "MZF1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
