Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MYO10 cdna clone

MYO10 cDNA Clone

Synonyms
MYO10; MYO10 cDNA Clone; MYO10 cdna clone
Ordering
For Research Use Only!
Sequence
atggataacttcttcaccgagggaacacgggtctggctgagagaaaatggccagcattttccaagtactgtaaattcctgtgcagaaggcatcgtcgtcttccggacagactatggtcaggtattcacttacaagcagagcacaattacccaccagaaggtgactgctatgcaccccacgaacgaggagggcgtggatgacatggcgtccttgacagagctccatggcggctccatcatgtataacttattccagcggtataagagaaatcaaatatatgtgcagataggttga
Sequence Length
294
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
163,554 Da
NCBI Official Full Name
Homo sapiens myosin X, mRNA
NCBI Official Synonym Full Names
myosin X
NCBI Official Symbol
MYO10
NCBI Protein Information
unconventional myosin-X
UniProt Protein Name
Unconventional myosin-X
Protein Family
UniProt Gene Name
MYO10
UniProt Synonym Gene Names
KIAA0799
UniProt Entry Name
MYO10_HUMAN

NCBI Description

This gene encodes a member of the myosin superfamily. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-10 (MYH10). Unconventional myosins contain the basic domains of conventional myosins and are further distinguished from class members by their tail domains. This gene functions as an actin-based molecular motor and plays a role in integration of F-actin and microtubule cytoskeletons during meiosis. [provided by RefSeq, Dec 2011]

Uniprot Description

MYO10: Myosins are actin-based motor molecules with ATPase activity. Unconventional myosins serve in intracellular movements. MYO10 binds to actin filaments and actin bundles and functions as plus end-directed motor. The tail domain binds to membranous compartments containing phosphatidylinositol 3,4,5-trisphosphate or integrins, and mediates cargo transport along actin filaments. Regulates cell shape, cell spreading and cell adhesion. Stimulates the formation and elongation of filopodia. May play a role in neurite outgrowth and axon guidance. Plays a role in formation of the podosome belt in osteoclasts.

Protein type: Motility/polarity/chemotaxis; Motor

Chromosomal Location of Human Ortholog: 5p15.1-p14.3

Cellular Component: cytoplasm; cytosol; filopodium tip; nucleolus; plasma membrane

Molecular Function: actin filament binding; actin-dependent ATPase activity; motor activity; phosphatidylinositol-3,4,5-triphosphate binding; plus-end directed microfilament motor activity; protein binding; spectrin binding

Biological Process: cytoskeleton-dependent intracellular transport; regulation of cell shape; regulation of filopodium formation

Research Articles on MYO10

Similar Products

Product Notes

The MYO10 myo10 (Catalog #AAA1267343) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggataact tcttcaccga gggaacacgg gtctggctga gagaaaatgg ccagcatttt ccaagtactg taaattcctg tgcagaaggc atcgtcgtct tccggacaga ctatggtcag gtattcactt acaagcagag cacaattacc caccagaagg tgactgctat gcaccccacg aacgaggagg gcgtggatga catggcgtcc ttgacagagc tccatggcgg ctccatcatg tataacttat tccagcggta taagagaaat caaatatatg tgcagatagg ttga. It is sometimes possible for the material contained within the vial of "MYO10, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.