Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

MYLK2 cdna clone

MYLK2 cDNA Clone

Gene Names
MYLK2; KMLC; MLCK; MLCK2; skMLCK
Synonyms
MYLK2; MYLK2 cDNA Clone; MYLK2 cdna clone
Ordering
 
When autocomplete results are available use up and down arrows to review and enter to select. Touch device users, explore by touch or with swipe gestures.
For Research Use Only!
Sequence
atggcgacagaaaatggagcagttgagctgggaattcagaacccatcaacagacaaggcacctaaaggtcccacaggtgaaagacccctggctgcagggaaagaccctggccccccagacccaaagaaagctccggatccacccaccctgaagaaagatgccaaagcccctgcctcagagaaaggggatggtaccctggcccaaccctcaactagcagccaaggccccaaaggagagggtgacaggggcggggggcccgcggagggcagtgctgggcccccggcagccctgccccagcagactgcgacacctgagaccagcgtcaagaagcccaaggctgagcagggagcctcaggcagccaggatcctggaaagcccagggtgggcaagaaggcagcagagggccaagcagcagccaggaggggctcacctgcctttctgcatagccccagctgtcctgccatcatctccagttctgagaagctgctggccaagaagcccccaagcgaggcatcagagctcacctttgaaggggtgcccatgacccacagccccacggatcccaggccagccaaggcagaagaaggaaagaacatcctggcagagagccagaaggaagtgggagagaaaaccccaggccaggctggccaggctaagatgcaaggggacacctcgagggggatcgagttccaggctgttccctcagagaaatccgaggtggggcaggccctctgtctcacagccagggaggaggactgcttccagattttggatgattgcccgccacctccggcccccttccctcaccgcatggtggagctgaggaccgggaatgtcagcagtgaattcagtatgaactccaaggaggcgctcggaggtggcaagtttggggcagtctgtacctgcatggagaaagccacaggcctcaagctggcagccaaggtcatcaagaaacagactcccaaagacaaggaaatggtgttgctggagattgaggtcatgaaccagctgaaccaccgcaatctgatccagctgtatgcagccatcgagactccgcatgagatcgtcctgttcatggagtacatcgagggcggagagctcttcgagaggattgtggatgaggactaccatctgaccgaggtggacaccatggtgtttgtcaggcagatctgtgacgggatcctcttcatgcacaagatgagggttttgcacctggacctcaagccagagaacatcctgtgtgtcaacaccaccgggcatttggtgaagatcattgactttggcctggcacggaggtataaccccaacgagaagctgaaggtgaactttgggaccccagagttcctgtcacctgaggtggtgaattatgaccaaatctccgataagacagacatgtggagtatgggggtgatcacctacatgctgctgagcggcctctcccccttcctgggagatgatgacacagagaccctaaacaacgttctatctggcaactggtactttgatgaagagacctttgaggccgtatcagacgaggccaaagactttgtctccaacctcatcgtcaaggaccagagggcccggatgaacgctgcccagtgtctcgcccatccctggctcaacaacctggcggagaaagccaaacgctgtaaccgacgccttaagtcccagatcttgcttaagaaatacctcatgaagaggcgctggaagaaaaacttcattgctgtcagcgctgccaaccgcttcaagaagatcagcagctcgggggcactgatggctctgggggtctga
Sequence Length
1791
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
64,685 Da
NCBI Official Full Name
Homo sapiens myosin light chain kinase 2, mRNA
NCBI Official Synonym Full Names
myosin light chain kinase 2
NCBI Official Symbol
MYLK2
NCBI Official Synonym Symbols
KMLC; MLCK; MLCK2; skMLCK
NCBI Protein Information
myosin light chain kinase 2, skeletal/cardiac muscle
UniProt Protein Name
Myosin light chain kinase 2, skeletal/cardiac muscle
Protein Family
UniProt Gene Name
MYLK2
UniProt Synonym Gene Names
MLCK2
UniProt Entry Name
MYLK2_HUMAN

NCBI Description

This gene encodes a myosin light chain kinase, a calcium/calmodulin dependent enzyme, that is exclusively expressed in adult skeletal muscle. [provided by RefSeq, Jul 2008]

Uniprot Description

skMLCK: a calcium/calmodulin dependent kinase of the MLCK family. A myosin light chain kinase that is exclusively expressed in adult skeletal muscle.

Protein type: Protein kinase, CAMK; Kinase, protein; Protein kinase, Ser/Thr (non-receptor); EC 2.7.11.18; Motility/polarity/chemotaxis; CAMK group; MLCK family

Chromosomal Location of Human Ortholog: 20q13.31

Cellular Component: cytoplasm; nucleus; sarcomere

Molecular Function: calmodulin binding; calmodulin-dependent protein kinase activity; myosin light chain kinase activity; protein binding

Biological Process: cardiac muscle contraction; cardiac muscle morphogensis; peptidyl-threonine phosphorylation; protein amino acid autophosphorylation; regulation of muscle filament sliding; striated muscle contraction

Disease: Cardiomyopathy, Familial Hypertrophic, 1

Research Articles on MYLK2

Similar Products

Product Notes

The MYLK2 mylk2 (Catalog #AAA1275230) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgacag aaaatggagc agttgagctg ggaattcaga acccatcaac agacaaggca cctaaaggtc ccacaggtga aagacccctg gctgcaggga aagaccctgg ccccccagac ccaaagaaag ctccggatcc acccaccctg aagaaagatg ccaaagcccc tgcctcagag aaaggggatg gtaccctggc ccaaccctca actagcagcc aaggccccaa aggagagggt gacaggggcg gggggcccgc ggagggcagt gctgggcccc cggcagccct gccccagcag actgcgacac ctgagaccag cgtcaagaag cccaaggctg agcagggagc ctcaggcagc caggatcctg gaaagcccag ggtgggcaag aaggcagcag agggccaagc agcagccagg aggggctcac ctgcctttct gcatagcccc agctgtcctg ccatcatctc cagttctgag aagctgctgg ccaagaagcc cccaagcgag gcatcagagc tcacctttga aggggtgccc atgacccaca gccccacgga tcccaggcca gccaaggcag aagaaggaaa gaacatcctg gcagagagcc agaaggaagt gggagagaaa accccaggcc aggctggcca ggctaagatg caaggggaca cctcgagggg gatcgagttc caggctgttc cctcagagaa atccgaggtg gggcaggccc tctgtctcac agccagggag gaggactgct tccagatttt ggatgattgc ccgccacctc cggccccctt ccctcaccgc atggtggagc tgaggaccgg gaatgtcagc agtgaattca gtatgaactc caaggaggcg ctcggaggtg gcaagtttgg ggcagtctgt acctgcatgg agaaagccac aggcctcaag ctggcagcca aggtcatcaa gaaacagact cccaaagaca aggaaatggt gttgctggag attgaggtca tgaaccagct gaaccaccgc aatctgatcc agctgtatgc agccatcgag actccgcatg agatcgtcct gttcatggag tacatcgagg gcggagagct cttcgagagg attgtggatg aggactacca tctgaccgag gtggacacca tggtgtttgt caggcagatc tgtgacggga tcctcttcat gcacaagatg agggttttgc acctggacct caagccagag aacatcctgt gtgtcaacac caccgggcat ttggtgaaga tcattgactt tggcctggca cggaggtata accccaacga gaagctgaag gtgaactttg ggaccccaga gttcctgtca cctgaggtgg tgaattatga ccaaatctcc gataagacag acatgtggag tatgggggtg atcacctaca tgctgctgag cggcctctcc cccttcctgg gagatgatga cacagagacc ctaaacaacg ttctatctgg caactggtac tttgatgaag agacctttga ggccgtatca gacgaggcca aagactttgt ctccaacctc atcgtcaagg accagagggc ccggatgaac gctgcccagt gtctcgccca tccctggctc aacaacctgg cggagaaagc caaacgctgt aaccgacgcc ttaagtccca gatcttgctt aagaaatacc tcatgaagag gcgctggaag aaaaacttca ttgctgtcag cgctgccaac cgcttcaaga agatcagcag ctcgggggca ctgatggctc tgggggtctg a. It is sometimes possible for the material contained within the vial of "MYLK2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.
Looking for a specific manual?
Request a Manual