Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MUM1 cdna clone

MUM1 cDNA Clone

Gene Names
MUM1; MUM-1; EXPAND1; HSPC211
Synonyms
MUM1; MUM1 cDNA Clone; MUM1 cdna clone
Ordering
For Research Use Only!
Sequence
atgctccccgaccgctcgcgggccgcccgggaccgggccaaccagaagctggtggagtacattgtgaaggccaagggcgcggagagccacctgcgggccatcctaaagagcaggaagccatctcgctggctgcagaccttcctgagctccagccagtacgtgacctgtgtggagacctacctggaggatgaggggcagctggacctggtggtgaagtacctgcagggcgtctaccaggaggtgggggccaaggtgctccagcgcaccaacggcgaccggatccggttcattctggacgtgcttctgcccgaggccatcatctgtgcgatctctgcggtggacgaggtggactacaagacggctgaggagaagtacatcaaggggccttcgctgagctaccgggaaaaagaaatatttgacaaccagctccttgaagagcggaaccggcgccgtcggtga
Sequence Length
459
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
80,700 Da
NCBI Official Full Name
Homo sapiens melanoma associated antigen (mutated) 1, mRNA
NCBI Official Synonym Full Names
melanoma associated antigen (mutated) 1
NCBI Official Symbol
MUM1
NCBI Official Synonym Symbols
MUM-1; EXPAND1; HSPC211
NCBI Protein Information
PWWP domain-containing protein MUM1
UniProt Protein Name
PWWP domain-containing protein MUM1
UniProt Gene Name
MUM1
UniProt Synonym Gene Names
EXPAND1; MUM-1
UniProt Entry Name
MUM1_HUMAN

Uniprot Description

MUM1: Involved in the DNA damage response pathway by contributing to the maintenance of chromatin architecture. Recruited to the vicinity of DNA breaks by TP53BP1 and plays an accessory role to facilitate damage-induced chromatin changes and promoting chromatin relaxation. Required for efficient DNA repair and cell survival following DNA damage. Belongs to the MUM1 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Cell surface

Chromosomal Location of Human Ortholog: 19p13.3

Cellular Component: cytoplasm; nucleus

Molecular Function: nucleosome binding; protein binding

Biological Process: DNA repair; establishment and/or maintenance of chromatin architecture

Research Articles on MUM1

Similar Products

Product Notes

The MUM1 mum1 (Catalog #AAA1274662) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctccccg accgctcgcg ggccgcccgg gaccgggcca accagaagct ggtggagtac attgtgaagg ccaagggcgc ggagagccac ctgcgggcca tcctaaagag caggaagcca tctcgctggc tgcagacctt cctgagctcc agccagtacg tgacctgtgt ggagacctac ctggaggatg aggggcagct ggacctggtg gtgaagtacc tgcagggcgt ctaccaggag gtgggggcca aggtgctcca gcgcaccaac ggcgaccgga tccggttcat tctggacgtg cttctgcccg aggccatcat ctgtgcgatc tctgcggtgg acgaggtgga ctacaagacg gctgaggaga agtacatcaa ggggccttcg ctgagctacc gggaaaaaga aatatttgac aaccagctcc ttgaagagcg gaaccggcgc cgtcggtga. It is sometimes possible for the material contained within the vial of "MUM1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.