Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MTMR7 cdna clone

MTMR7 cDNA Clone

Synonyms
MTMR7; MTMR7 cDNA Clone; MTMR7 cdna clone
Ordering
For Research Use Only!
Sequence
atggagcacatccgcacgcccaaggttgaaaatgtccgcttggtagatcgagtgtctcctaaaaaagcagctctaggtactttgtatttgacggctacccatgtcatattcgtggaaaattcacctgacgcaagaaaagaaacatggattcttcacagtcagatttccaccattgagaaacaggcaacaaccgctaccggatgccctctgctgattcgctgcaagaactttcagataatacagctcatcatacctcaggaaagagattgccacgacgtgtacatctccctgatacgccttgcaaggccagtgaaatatgaggagttatactgcttttcattcaaccccatgctggataaagaagaaagagagcaaggctgggtgctgatcgatcttagtgaagaatacacgcggatgggcctccctaatcattactggcagctcagcgatgtgaatagagactatagagtctgtgactcttatcctactgaactgtacgttcccaaatcggccacggcacacatcatagtggggagttccaaattccggagtagacggcgatttcctgtcctttcttactattataaagataaccacgcctccatctgccggagcagccagcccctgtccggcttcagtgcccggtgcctggaggacgagcagatgctccaggccattaggaaagccaatccaggaagtgacttcgtttatgtcgttgacacccggcctaaacttaatgcaatggcaaatcgtgctgcagggaaaggctatgagaatgaagacaattattccaatatcaagtttcagtttatcgggatagagaacatccatgtcatgaggaacagtctgcagaaaatgctggaagtgtgtgaacttaaatctccctccatgagtgatttcctgtggggtctggagaactctggctggttaaggcacattaaagccataatggatgcaggaatcttcattgcaaaggcagtgtcagaggaaggggcaagtgtgcttgttcactgttctgatggctgggacaggaccgctcaggtgtgctcggtggcaagcctgctgctggaccctcactaccggactctgaagggcttcatggtattaattgaaaaggactggatttcctttggtcataagtttaatcaccgatatggcaatctagatggtgacccaaaagaaatctctccagttattgaccagttcattgagtgtgtttggcagttaatggaacaatttccctgtgcctttgagttcaatgagaggtttttgattcacattcaacatcacatttattcctgccagtttggaaacttcctatgtaacagccaaaaggagagacgagaactcaagattcaagaaagaacatactcattatgggctcacctgtggaagaatcgggccgactacctgaatcctctgtttagagctgatcacagccagactcagggaacccttcatctccctacaacaccatgtaacttcatgtacaagttttggagtggaatgtataaccgctttgaaaaggggatgcagccccgacagtcagttacagattacctaatggcagtgaaggaagaaactcagcagctagaggaagaactagaggccctggaagaaaggctggaaaaaattcaaaaggtccagttaaattgcactaaggtgaagagtaagcaaagtgagcccagcaagcactcagggttttctacctcagacaacagcatagccaacactccccaggattacagtgggaatatgaaatcatttccatcccggagcccttcacaaggcgatgaagattctgctctgattctaacccaagacaatctgaaaagttcagatccagatctgtcagccaacagtgaccaagagtccggggtggaggatttgagctgtcggtctccaagtggtggtgagcatgcaccgagtgaagatagtggcaaggaccgggattctgatgaagccgtgtttctcactgcctga
Sequence Length
1983
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
64,702 Da
NCBI Official Full Name
Homo sapiens myotubularin related protein 7, mRNA
NCBI Official Synonym Full Names
myotubularin related protein 7
NCBI Official Symbol
MTMR7
NCBI Protein Information
myotubularin-related protein 7
UniProt Protein Name
Myotubularin-related protein 7
UniProt Gene Name
MTMR7
UniProt Entry Name
MTMR7_HUMAN

NCBI Description

This gene encodes a member of the myotubularin family of tyrosine/dual-specificity phosphatases. The encoded protein is characterized by four distinct domains that are conserved among all members of the myotubularin family: the glucosyltransferase, Rab-like GTPase activator and myotubularins domain, the Rac-induced recruitment domain, the protein tyrosine phosphatases and dual-specificity phosphatases domain and the suppressor of variegation 3-9, enhancer-of-zeste, and trithorax interaction domain. This protein dephosphorylates the target substrates phosphatidylinositol 3-phosphate and inositol 1,3-bisphosphate. A pseudogene of this gene is found on chromosome 5. [provided by RefSeq, Mar 2009]

Uniprot Description

MTMR7: a protein of the myotubularin family. Myotubularins are a family of unique protein tyrosine phosphatases that utilize inositol phospholipids, rather than phosphoproteins, as physiological substrates. Myotubularins specifically dephosphorylate phosphatidylinositol 3-phosphate [PI(3)P] and phosphatidylinositol 3,5-bisphosphate [PI(3,5)P2], generating phosphatidylinositol and phosphatidylinositol 5-phosphate [PI(5)P], respectively. PI(3)P and PI(3,5)P2 regulate membrane trafficking events through the recruitment of effector proteins containing the lipid-binding domains FYVE, PH, and ENTH. MTMR5, -9, -10, -11, -12, -13 are catalytically inactive lipid phosphatases but may mediate important protein-protein interactions. Expressed at high levels in the brain. Two alternatively spliced human isoforms have been described.

Protein type: Motility/polarity/chemotaxis; Phosphatase, lipid; EC 3.1.3.-; Protein phosphatase, tyrosine (non-receptor)

Chromosomal Location of Human Ortholog: 8p22

Cellular Component: cytosol

Molecular Function: phosphatidylinositol-3-phosphatase activity; protein binding

Biological Process: phosphatidylinositol biosynthetic process; protein amino acid dephosphorylation

Research Articles on MTMR7

Similar Products

Product Notes

The MTMR7 mtmr7 (Catalog #AAA1274837) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagcaca tccgcacgcc caaggttgaa aatgtccgct tggtagatcg agtgtctcct aaaaaagcag ctctaggtac tttgtatttg acggctaccc atgtcatatt cgtggaaaat tcacctgacg caagaaaaga aacatggatt cttcacagtc agatttccac cattgagaaa caggcaacaa ccgctaccgg atgccctctg ctgattcgct gcaagaactt tcagataata cagctcatca tacctcagga aagagattgc cacgacgtgt acatctccct gatacgcctt gcaaggccag tgaaatatga ggagttatac tgcttttcat tcaaccccat gctggataaa gaagaaagag agcaaggctg ggtgctgatc gatcttagtg aagaatacac gcggatgggc ctccctaatc attactggca gctcagcgat gtgaatagag actatagagt ctgtgactct tatcctactg aactgtacgt tcccaaatcg gccacggcac acatcatagt ggggagttcc aaattccgga gtagacggcg atttcctgtc ctttcttact attataaaga taaccacgcc tccatctgcc ggagcagcca gcccctgtcc ggcttcagtg cccggtgcct ggaggacgag cagatgctcc aggccattag gaaagccaat ccaggaagtg acttcgttta tgtcgttgac acccggccta aacttaatgc aatggcaaat cgtgctgcag ggaaaggcta tgagaatgaa gacaattatt ccaatatcaa gtttcagttt atcgggatag agaacatcca tgtcatgagg aacagtctgc agaaaatgct ggaagtgtgt gaacttaaat ctccctccat gagtgatttc ctgtggggtc tggagaactc tggctggtta aggcacatta aagccataat ggatgcagga atcttcattg caaaggcagt gtcagaggaa ggggcaagtg tgcttgttca ctgttctgat ggctgggaca ggaccgctca ggtgtgctcg gtggcaagcc tgctgctgga ccctcactac cggactctga agggcttcat ggtattaatt gaaaaggact ggatttcctt tggtcataag tttaatcacc gatatggcaa tctagatggt gacccaaaag aaatctctcc agttattgac cagttcattg agtgtgtttg gcagttaatg gaacaatttc cctgtgcctt tgagttcaat gagaggtttt tgattcacat tcaacatcac atttattcct gccagtttgg aaacttccta tgtaacagcc aaaaggagag acgagaactc aagattcaag aaagaacata ctcattatgg gctcacctgt ggaagaatcg ggccgactac ctgaatcctc tgtttagagc tgatcacagc cagactcagg gaacccttca tctccctaca acaccatgta acttcatgta caagttttgg agtggaatgt ataaccgctt tgaaaagggg atgcagcccc gacagtcagt tacagattac ctaatggcag tgaaggaaga aactcagcag ctagaggaag aactagaggc cctggaagaa aggctggaaa aaattcaaaa ggtccagtta aattgcacta aggtgaagag taagcaaagt gagcccagca agcactcagg gttttctacc tcagacaaca gcatagccaa cactccccag gattacagtg ggaatatgaa atcatttcca tcccggagcc cttcacaagg cgatgaagat tctgctctga ttctaaccca agacaatctg aaaagttcag atccagatct gtcagccaac agtgaccaag agtccggggt ggaggatttg agctgtcggt ctccaagtgg tggtgagcat gcaccgagtg aagatagtgg caaggaccgg gattctgatg aagccgtgtt tctcactgcc tga. It is sometimes possible for the material contained within the vial of "MTMR7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.