Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MTMR12 cdna clone

MTMR12 cDNA Clone

Gene Names
MTMR12; 3-PAP; PIP3AP
Synonyms
MTMR12; MTMR12 cDNA Clone; MTMR12 cdna clone
Ordering
For Research Use Only!
Sequence
atgctggggaaaggagtagtcggcggtggcggcggcaccaaggcccccaagccctccttcgtgtcgtacgtacgccctgaggaaattcacacaaacgaaaaggaagtaacagagaaggaagtaactcttcacttgttgccaggtgaacagctgctttgtgaagccagcacagtactgaagtatgtccaggaagattcctgtcagcatggggtctatgggaggcttgtctgcacagacttcaagattgccttcttgggtgatgatgaatctgcattggataatgatgaaactcaatttaagaataaggttataggagaaaatgacattacactccactgtgttgatcagatttatggagtgtttgatgagaaaaagaaaactctctttggacaactgaagaaataccctgagaagctcatcatccactgcaaagaccttcgagtgttccagttttgtctgaggtacacaaaggaagaggaagtcaaaaggattgtcagtggcataattcatcatacccaggctcctaaactgcttaaacgattatttctgttttcctatgcgactgctgcacaaaacaatacagtcactgatcccaagaaccataccgtaatgtttgacacacttaaggactggtgttgggaactggaacggaccaaaggcaacatgaagtacaaagcagtgagtgtcaacgaaggctataaagtctgtgagagattgccagcatactttgttgtccccacccctcttcctgaagagaatgtgcagcgctttcagggtcatggcataccaatatggtgttggtcctgccacaatggaagtgcccttttgaaaatgtcagcactgcccaaagaacaggatgacggcattttacaaatccaaaagagcttcttagatggaatttacaagaccatccacaggccaccctatgaaattgttaaaacggaagacctgtcaagcaacttcctgtccctgcaggaaatccagactgcatactctaaatttaaacagctatttctgatagataacagtactgaattttgggacacagatataaaatggttttctctgttggaaagtagcagctggcttgacataatcagacgttgcctgaaaaaagcaatagagattacagaatgtatggaagcacaaaacatgaatgttcttcttttagaggagaatgcatccgacctctgctgtctcatttcctctctggtgcaactgatgatggacccccactgcagaaccagaattggtttccagagcctcatccaaaaggagtgggtcatgggtggccactgtttcttggatcgctgcaaccatctccgccagaacgacaaagaggaggttcctgtgttcctgcttttcctagattgtgtctggcagctggtgcaccagcatcccccggcatttgaattcacagagacttacctgactgttttgtcagatagcctgtatatacctatttttagcaccttcttcttcaattcacctcatcaaaaagatactaacatgcatcaacgacaactttctttgccacttacacaatctaagtcatctcccaaaagaggatttttcagggaagaaacagatcatttaattaaaaaccttctgggcaagagaattagcaaacttattaattcttctgatgagctccaagacaactttcgagagttctatgacagctggcatagcaagtccactgactaccatggtttgttgttaccgcatatcgaggggcccgaaatcaaagtctgggcccagcgctacctacgttggattccagaagcccaaatcctaggtggtggccaagtggccactctgagcaaactcttggaaatgatggaggaagtccagagtttacaagagaagatcgacgagagacaccacagccagcaggccccccaggctgaggccccctgcctgctgaggaactctgcccgcctctcgtctttgtttcctttcgctctgctccagcgacattcctctaagcccgtcttacccaccagtggctggaaagctttgggagatgaagacgatttggccaaacgagaagatgagttcgtggacctaggggatgtgtga
Sequence Length
2082
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
73,232 Da
NCBI Official Full Name
Homo sapiens myotubularin related protein 12, mRNA
NCBI Official Synonym Full Names
myotubularin related protein 12
NCBI Official Symbol
MTMR12
NCBI Official Synonym Symbols
3-PAP; PIP3AP
NCBI Protein Information
myotubularin-related protein 12
UniProt Protein Name
Myotubularin-related protein 12
UniProt Gene Name
MTMR12
UniProt Synonym Gene Names
KIAA1682; PIP3AP; 3-PAP; 3-phosphatase adapter protein
UniProt Entry Name
MTMRC_HUMAN

NCBI Description

Phosphatidylinositide 3-kinase-derived membrane-anchored phosphatidylinositides, such as phosphatidylinositol 3-phosphate (PtdIns(3)P), regulate diverse cellular processes. The protein encoded by this gene functions as an adaptor subunit in a complex with an active PtdIns(3)P 3-phosphatase. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]

Uniprot Description

MTMR12: Catalytically inactive phosphatase that plays a role as an adapter for the phosphatase myotubularin to regulate myotubularin intracellular location. Belongs to the protein-tyrosine phosphatase family. Non-receptor class myotubularin subfamily. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Adaptor/scaffold; Protein phosphatase, tyrosine (non-receptor)

Chromosomal Location of Human Ortholog: 5p13.3

Molecular Function: protein binding

Research Articles on MTMR12

Similar Products

Product Notes

The MTMR12 mtmr12 (Catalog #AAA1277586) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgggga aaggagtagt cggcggtggc ggcggcacca aggcccccaa gccctccttc gtgtcgtacg tacgccctga ggaaattcac acaaacgaaa aggaagtaac agagaaggaa gtaactcttc acttgttgcc aggtgaacag ctgctttgtg aagccagcac agtactgaag tatgtccagg aagattcctg tcagcatggg gtctatggga ggcttgtctg cacagacttc aagattgcct tcttgggtga tgatgaatct gcattggata atgatgaaac tcaatttaag aataaggtta taggagaaaa tgacattaca ctccactgtg ttgatcagat ttatggagtg tttgatgaga aaaagaaaac tctctttgga caactgaaga aataccctga gaagctcatc atccactgca aagaccttcg agtgttccag ttttgtctga ggtacacaaa ggaagaggaa gtcaaaagga ttgtcagtgg cataattcat catacccagg ctcctaaact gcttaaacga ttatttctgt tttcctatgc gactgctgca caaaacaata cagtcactga tcccaagaac cataccgtaa tgtttgacac acttaaggac tggtgttggg aactggaacg gaccaaaggc aacatgaagt acaaagcagt gagtgtcaac gaaggctata aagtctgtga gagattgcca gcatactttg ttgtccccac ccctcttcct gaagagaatg tgcagcgctt tcagggtcat ggcataccaa tatggtgttg gtcctgccac aatggaagtg cccttttgaa aatgtcagca ctgcccaaag aacaggatga cggcatttta caaatccaaa agagcttctt agatggaatt tacaagacca tccacaggcc accctatgaa attgttaaaa cggaagacct gtcaagcaac ttcctgtccc tgcaggaaat ccagactgca tactctaaat ttaaacagct atttctgata gataacagta ctgaattttg ggacacagat ataaaatggt tttctctgtt ggaaagtagc agctggcttg acataatcag acgttgcctg aaaaaagcaa tagagattac agaatgtatg gaagcacaaa acatgaatgt tcttctttta gaggagaatg catccgacct ctgctgtctc atttcctctc tggtgcaact gatgatggac ccccactgca gaaccagaat tggtttccag agcctcatcc aaaaggagtg ggtcatgggt ggccactgtt tcttggatcg ctgcaaccat ctccgccaga acgacaaaga ggaggttcct gtgttcctgc ttttcctaga ttgtgtctgg cagctggtgc accagcatcc cccggcattt gaattcacag agacttacct gactgttttg tcagatagcc tgtatatacc tatttttagc accttcttct tcaattcacc tcatcaaaaa gatactaaca tgcatcaacg acaactttct ttgccactta cacaatctaa gtcatctccc aaaagaggat ttttcaggga agaaacagat catttaatta aaaaccttct gggcaagaga attagcaaac ttattaattc ttctgatgag ctccaagaca actttcgaga gttctatgac agctggcata gcaagtccac tgactaccat ggtttgttgt taccgcatat cgaggggccc gaaatcaaag tctgggccca gcgctaccta cgttggattc cagaagccca aatcctaggt ggtggccaag tggccactct gagcaaactc ttggaaatga tggaggaagt ccagagttta caagagaaga tcgacgagag acaccacagc cagcaggccc cccaggctga ggccccctgc ctgctgagga actctgcccg cctctcgtct ttgtttcctt tcgctctgct ccagcgacat tcctctaagc ccgtcttacc caccagtggc tggaaagctt tgggagatga agacgatttg gccaaacgag aagatgagtt cgtggaccta ggggatgtgt ga. It is sometimes possible for the material contained within the vial of "MTMR12, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.