Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MPZL2 cdna clone

MPZL2 cDNA Clone

Gene Names
MPZL2; EVA; EVA1
Synonyms
MPZL2; MPZL2 cDNA Clone; MPZL2 cdna clone
Ordering
For Research Use Only!
Sequence
atgtatggcaagagctctactcgtgcggtgcttcttctccttggcatacagctcacagctctttggcctatagcagctgtggaaatttatacctcccgggtgctggaggctgttaatgggacagatgctcggttaaaatgcactttctccagctttgcccctgtgggtgatgctctaacagtgacctggaattttcgtcctctagacgggggacctgagcagtttgtattctactaccacatagatcccttccaacccatgagtgggcggtttaaggaccgggtgtcttgggatgggaatcctgagcggtacgatgcctccatccttctctggaaactgcagttcgacgacaatgggacatacacctgccaggtgaagaacccacctgatgttgatggggtgataggggagatccggctcagcgtcgtgcacactgtacgcttctctgagatccacttcctggctctggccattggctctgcctgtgcactgatgatcataatagtaattgtagtggtcctcttccagcattaccggaaaaagcgatgggccgaaagagctcataaagtggtggagataaaatcaaaagaagaggaaaggctcaaccaagagaaaaaggtctctgtttatttagaagacacagactaa
Sequence Length
648
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,484 Da
NCBI Official Full Name
Homo sapiens myelin protein zero-like 2, mRNA
NCBI Official Synonym Full Names
myelin protein zero like 2
NCBI Official Symbol
MPZL2
NCBI Official Synonym Symbols
EVA; EVA1
NCBI Protein Information
myelin protein zero-like protein 2
UniProt Protein Name
Myelin protein zero-like protein 2
UniProt Gene Name
MPZL2
UniProt Synonym Gene Names
EVA; EVA1
UniProt Entry Name
MPZL2_HUMAN

NCBI Description

Thymus development depends on a complex series of interactions between thymocytes and the stromal component of the organ. Epithelial V-like antigen (EVA) is expressed in thymus epithelium and strongly downregulated by thymocyte developmental progression. This gene is expressed in the thymus and in several epithelial structures early in embryogenesis. It is highly homologous to the myelin protein zero and, in thymus-derived epithelial cell lines, is poorly soluble in nonionic detergents, strongly suggesting an association to the cytoskeleton. Its capacity to mediate cell adhesion through a homophilic interaction and its selective regulation by T cell maturation might imply the participation of EVA in the earliest phases of thymus organogenesis. The protein bears a characteristic V-type domain and two potential N-glycosylation sites in the extracellular domain; a putative serine phosphorylation site for casein kinase 2 is also present in the cytoplasmic tail. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

MPZL2: Mediates homophilic cell-cell adhesion. Belongs to the myelin P0 protein family.

Protein type: Membrane protein, integral; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 11q24

Cellular Component: cytoskeleton

Molecular Function: protein binding

Biological Process: anatomical structure morphogenesis; homophilic cell adhesion

Research Articles on MPZL2

Similar Products

Product Notes

The MPZL2 mpzl2 (Catalog #AAA1272157) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtatggca agagctctac tcgtgcggtg cttcttctcc ttggcataca gctcacagct ctttggccta tagcagctgt ggaaatttat acctcccggg tgctggaggc tgttaatggg acagatgctc ggttaaaatg cactttctcc agctttgccc ctgtgggtga tgctctaaca gtgacctgga attttcgtcc tctagacggg ggacctgagc agtttgtatt ctactaccac atagatccct tccaacccat gagtgggcgg tttaaggacc gggtgtcttg ggatgggaat cctgagcggt acgatgcctc catccttctc tggaaactgc agttcgacga caatgggaca tacacctgcc aggtgaagaa cccacctgat gttgatgggg tgatagggga gatccggctc agcgtcgtgc acactgtacg cttctctgag atccacttcc tggctctggc cattggctct gcctgtgcac tgatgatcat aatagtaatt gtagtggtcc tcttccagca ttaccggaaa aagcgatggg ccgaaagagc tcataaagtg gtggagataa aatcaaaaga agaggaaagg ctcaaccaag agaaaaaggt ctctgtttat ttagaagaca cagactaa. It is sometimes possible for the material contained within the vial of "MPZL2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.