MPZL1 cdna clone
MPZL1 cDNA Clone
Gene Names
MPZL1; PZR; PZRa; PZRb; PZR1b; MPZL1b
Synonyms
MPZL1; MPZL1 cDNA Clone; MPZL1 cdna clone
Sequence
atggcagcgtccgccggagccggggcggtgattgcagccccagacagccggcgctggctgtggtcggtgctggcggcggcgcttgggctcttgacagctggagtatcagccttggaagtatatacgccaaaagaaatcttcgtggcaaatggtacacaagggaagctgacctgcaagttcaagtctactagtacgactggcgggttgacctcagtctcctggagcttccagccagagggggccgacactactgtgtcgtttttccactactcccaagggcaagtgtaccttgggaattatccaccatttaaagacagaatcagctgggctggagaccttgacaagaaagatgcatcaatcaacatagaaaatatgcagtttatacacaatggcacctatatctgtgatgtcaaaaaccctcctgacatcgttgtccagcctggacacattaggctctatgtcgtagaaaaagagaatttgcctgtgtttccagtttgggtagtggtgggcatagttactgctgtggtcctaggtctcactctgctcatcagcatgattctggctgtcctctatagaaggaaaaactctaaacgggattacactggctgcagtacatcagagagtttgtcaccagttaagcaggctcctcggaagtccccctccgacactgagggtcttgtaaagagtctgccttctggatctcaccagggcccagtcatatatgcacagttagaccactccggcggacatcacagtgacaagattaacaagtcagagtctgtggtgtatgcggatatccgaaagaattaa
Sequence Length
810
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
12,354 Da
NCBI Official Full Name
Homo sapiens myelin protein zero-like 1, mRNA
NCBI Official Synonym Full Names
myelin protein zero like 1
NCBI Official Symbol
MPZL1
NCBI Official Synonym Symbols
PZR; PZRa; PZRb; PZR1b; MPZL1b
NCBI Protein Information
myelin protein zero-like protein 1
UniProt Protein Name
Myelin protein zero-like protein 1
Protein Family
UniProt Gene Name
MPZL1
UniProt Synonym Gene Names
PZR
UniProt Entry Name
MPZL1_HUMAN
Uniprot Description
PZR: an immunoglobulin superfamily cell surface protein. Contains two tyrosine-based inhibition motifs (ITIMs) responsible for binding of SHP-2. When phosphorylated, it can specifically bind SHP-2, blocking its translocation, and interupting its function. Treatment of several cell lines with ConA caused tyrosine phosphorylation of PZR. Two alternatively spliced isoforms have been reported. One isoform, PZR1b, lacks the ITIMs and has a dominant negative effect upon full-length PZR and its recruitment of SHP-2.
Protein type: Membrane protein, integral; Adaptor/scaffold
Chromosomal Location of Human Ortholog: 1q24.2
Cellular Component: cell surface; focal adhesion
Molecular Function: protein binding; structural molecule activity
Biological Process: cell-cell signaling; transmembrane receptor protein tyrosine kinase signaling pathway
Research Articles on MPZL1
Similar Products
Product Notes
The MPZL1 mpzl1 (Catalog #AAA1266347) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagcgt ccgccggagc cggggcggtg attgcagccc cagacagccg gcgctggctg tggtcggtgc tggcggcggc gcttgggctc ttgacagctg gagtatcagc cttggaagta tatacgccaa aagaaatctt cgtggcaaat ggtacacaag ggaagctgac ctgcaagttc aagtctacta gtacgactgg cgggttgacc tcagtctcct ggagcttcca gccagagggg gccgacacta ctgtgtcgtt tttccactac tcccaagggc aagtgtacct tgggaattat ccaccattta aagacagaat cagctgggct ggagaccttg acaagaaaga tgcatcaatc aacatagaaa atatgcagtt tatacacaat ggcacctata tctgtgatgt caaaaaccct cctgacatcg ttgtccagcc tggacacatt aggctctatg tcgtagaaaa agagaatttg cctgtgtttc cagtttgggt agtggtgggc atagttactg ctgtggtcct aggtctcact ctgctcatca gcatgattct ggctgtcctc tatagaagga aaaactctaa acgggattac actggctgca gtacatcaga gagtttgtca ccagttaagc aggctcctcg gaagtccccc tccgacactg agggtcttgt aaagagtctg ccttctggat ctcaccaggg cccagtcata tatgcacagt tagaccactc cggcggacat cacagtgaca agattaacaa gtcagagtct gtggtgtatg cggatatccg aaagaattaa. It is sometimes possible for the material contained within the vial of "MPZL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
