Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MMS19 cdna clone

MMS19 cDNA Clone

Gene Names
MMS19; MET18; MMS19L; hMMS19
Synonyms
MMS19; MMS19 cDNA Clone; MMS19 cdna clone
Ordering
For Research Use Only!
Sequence
atgcgggagcttttggaactgagctgctgccacagctgccccttttcttccaccgctgctgccaagtgctttgcaggactcctcaacaagcaccctgcagggcagcagctggatgaattcctacagctagctgtggacaaagtggaggctggcctgggctctgggccctgtcgtagtcaggccttcactcttcttctctgggtaacaaaggccctagtgctcagataccatcctctcagctcctgccttacagcccggctcatgggcctcctgagtgacccagaattaggtccagcagcagctgatggcttctctctgctcatgtctgactgcactgatgtgctgactcgtgctggccatgctgaagtgcggatcatgttccgccagcggttcttcacagataatgtgcctgctttggtccagggcttccatgctgctccccaagatgtgaagccaaactacttgaagggtctttctcatgtacttaacaggctgcccaagcctgtactcttgccagagctgcccacgcttctttccttgctgctggaggccctgtcctgccctgactgtgtggtgcagctctccaccctcagctgccttcagcctcttctactggaagcaccccaagtcatgagtcttcacgtggacaccctcgtcaccaagtttctgaacctcagctctagcccttccatggctgtccggatcgccgcactgcagtgcatgcatgctctcactcgcctgcccacccctgtgctgctgccgtacaaaccacaggtgattcgggccttagccaaacccctggatgacaagaagagactggtgcgcaaggaagcagtgtcagccagaggggagtggtttctgttggggagccctggcagctga
Sequence Length
882
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
108,380 Da
NCBI Official Full Name
Homo sapiens MMS19 nucleotide excision repair homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
MMS19 homolog, cytosolic iron-sulfur assembly component
NCBI Official Symbol
MMS19
NCBI Official Synonym Symbols
MET18; MMS19L; hMMS19
NCBI Protein Information
MMS19 nucleotide excision repair protein homolog
UniProt Protein Name
MMS19 nucleotide excision repair protein homolog
UniProt Gene Name
MMS19
UniProt Synonym Gene Names
MMS19L; hMMS19
UniProt Entry Name
MMS19_HUMAN

Uniprot Description

MMS19: Key component of the cytosolic iron-sulfur protein assembly (CIA) complex, a multiprotein complex that mediates the incorporation of iron-sulfur cluster into apoproteins specifically involved in DNA metabolism and genomic integrity. In the CIA complex, MMS19 acts as an adapter between early-acting CIA components and a subset of cellular target iron-sulfur proteins such as ERCC2/XPD, FANCJ and RTEL1, thereby playing a key role in nucleotide excision repair (NER) and RNA polymerase II (POL II) transcription. As part of the mitotic spindle-associated MMXD complex, plays a role in chromosome segregation, probably by facilitating iron-sulfur cluster assembly into ERCC2/XPD. Indirectly acts as a transcriptional coactivator of estrogen receptor (ER), via its role in iron-sulfur insertion into some component of the TFIIH-machinery. Belongs to the MET18/MMS19 family. 6 isoforms of the human protein are produced by alternative splicing.

Protein type: Nuclear receptor co-regulator

Chromosomal Location of Human Ortholog: 10q24-q25

Cellular Component: cytoplasm; membrane; nucleoplasm; nucleus; spindle

Molecular Function: estrogen receptor binding; protein binding; transcription coactivator activity

Biological Process: chromosome segregation; DNA metabolic process; DNA repair; iron-sulfur cluster assembly; nucleotide-excision repair; positive regulation of transcription, DNA-dependent; response to DNA damage stimulus

Research Articles on MMS19

Similar Products

Product Notes

The MMS19 mms19 (Catalog #AAA1275663) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcgggagc ttttggaact gagctgctgc cacagctgcc ccttttcttc caccgctgct gccaagtgct ttgcaggact cctcaacaag caccctgcag ggcagcagct ggatgaattc ctacagctag ctgtggacaa agtggaggct ggcctgggct ctgggccctg tcgtagtcag gccttcactc ttcttctctg ggtaacaaag gccctagtgc tcagatacca tcctctcagc tcctgcctta cagcccggct catgggcctc ctgagtgacc cagaattagg tccagcagca gctgatggct tctctctgct catgtctgac tgcactgatg tgctgactcg tgctggccat gctgaagtgc ggatcatgtt ccgccagcgg ttcttcacag ataatgtgcc tgctttggtc cagggcttcc atgctgctcc ccaagatgtg aagccaaact acttgaaggg tctttctcat gtacttaaca ggctgcccaa gcctgtactc ttgccagagc tgcccacgct tctttccttg ctgctggagg ccctgtcctg ccctgactgt gtggtgcagc tctccaccct cagctgcctt cagcctcttc tactggaagc accccaagtc atgagtcttc acgtggacac cctcgtcacc aagtttctga acctcagctc tagcccttcc atggctgtcc ggatcgccgc actgcagtgc atgcatgctc tcactcgcct gcccacccct gtgctgctgc cgtacaaacc acaggtgatt cgggccttag ccaaacccct ggatgacaag aagagactgg tgcgcaagga agcagtgtca gccagagggg agtggtttct gttggggagc cctggcagct ga. It is sometimes possible for the material contained within the vial of "MMS19, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.