Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MMP13 cdna clone

MMP13 cDNA Clone

Gene Names
MMP13; CLG3; MDST; MANDP1; MMP-13
Synonyms
MMP13; MMP13 cDNA Clone; MMP13 cdna clone
Ordering
For Research Use Only!
Sequence
atgcatccaggggtcctggctgccttcctcttcttgagctggactcattgtcgggccctgccccttcccagtggtggtgatgaagatgatttgtctgaggaagacctccagtttgcagagcgctacctgagatcatactaccatcctacaaatctcgcgggaatcctgaaggagaatgcagcaagctccatgactgagaggctccgagaaatgcagtctttcttcggcttagaggtgactggcaaacttgacgataacaccttagatgtcatgaaaaagccaagatgcggggttcctgatgtgggtgaatacaatgttttccctcgaactcttaaatggtccaaaatgaatttaacctacagaattgtgaattacacccctgatatgactcattctgaagtcgaaaaggcattcaaaaaagccttcaaagtttggtccgatgtaactcctctgaattttaccagacttcacgatggcattgctgacatcatgatctcttttggaattaaggagcatggcgacttctacccatttgatgggccctctggcctgctggctcatgcttttcctcctgggccaaattatggaggagatgcccattttgatgatgatgaaacctggacaagtagttccaaaggctacaacttgtttcttgttgctgcgcatgagttcggccactccttaggtcttgaccactccaaggaccctggagcactcatgtttcctatctacacctacaccggcaaaagccactttatgcttcctgatgacgatgtacaagggatccagtctctctatggtccaggagatgaagaccccaaccctaaacatccaaaaacgccagacaaatgtgacccttccttatcccttgatgccattaccagtctccgaggagaaacaatgatctttaaagacagattcttctggcgcctgcatcctcagcaggttgatgcggagctgtttttaacgaaatcattttggccagaacttcccaaccgtattgatgctgcatatgagcacccttctcatgacctcatcttcatcttcagaggtagaaaattttgggctcttaatggttatgacattctggaaggttatcccaaaaaaatatctgaactgggtcttccaaaagaagttaagaagataagtgcagctgttcactttgaggatacaggcaagactctcctgttctcaggaaaccaggtctggagatatgatgatactaaccatattatggataaagactatccgagactaatagaagaagacttcccaggaattggtgataaagtagatgctgtctatgagaaaaatggttatatctattttttcaacggacccatacagtttgaatacagcatctggagtaaccgtattgttcgcgtcatgccagcaaattccattttgtggtgttaa
Sequence Length
1416
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
53,820 Da
NCBI Official Full Name
Homo sapiens matrix metallopeptidase 13 (collagenase 3), mRNA
NCBI Official Synonym Full Names
matrix metallopeptidase 13
NCBI Official Symbol
MMP13
NCBI Official Synonym Symbols
CLG3; MDST; MANDP1; MMP-13
NCBI Protein Information
collagenase 3
UniProt Protein Name
Collagenase 3
Protein Family
UniProt Gene Name
MMP13
UniProt Synonym Gene Names
MMP-13
UniProt Entry Name
MMP13_HUMAN

NCBI Description

This gene encodes a member of the peptidase M10 family of matrix metalloproteinases (MMPs). Proteins in this family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease cleaves type II collagen more efficiently than types I and III. It may be involved in articular cartilage turnover and cartilage pathophysiology associated with osteoarthritis. Mutations in this gene are associated with metaphyseal anadysplasia. This gene is part of a cluster of MMP genes on chromosome 11. [provided by RefSeq, Jan 2016]

Uniprot Description

MMP13: Degrades collagen type I. Does not act on gelatin or casein. Could have a role in tumoral process. Defects in MMP13 are the cause of spondyloepimetaphyseal dysplasia Missouri type (SEMD-MO). A bone disease characterized by moderate to severe metaphyseal changes, mild epiphyseal involvement, rhizomelic shortening of the lower limbs with bowing of the femora and/or tibiae, coxa vara, genu varum and pear-shaped vertebrae in childhood. Epimetaphyseal changes improve with age. Defects in MMP13 are the cause of metaphyseal anadysplasia type 1 (MANDP1). Metaphyseal anadysplasia consists of an abnormal bone development characterized by severe skeletal changes that, in contrast with the progressive course of most other skeletal dysplasias, resolve spontaneously with age. Clinical characteristics are evident from the first months of life and include slight shortness of stature and a mild varus deformity of the legs. Patients attain a normal stature in adolescence and show improvement or complete resolution of varus deformity of the legs and rhizomelic micromelia. Belongs to the peptidase M10A family.

Protein type: Secreted; EC 3.4.24.-; Protease; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 11q22.3

Cellular Component: extracellular region

Molecular Function: calcium ion binding; collagen binding; metalloendopeptidase activity; serine-type endopeptidase activity; zinc ion binding

Biological Process: collagen catabolic process; extracellular matrix disassembly

Disease: Spondyloepimetaphyseal Dysplasia, Missouri Type

Research Articles on MMP13

Similar Products

Product Notes

The MMP13 mmp13 (Catalog #AAA1270816) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcatccag gggtcctggc tgccttcctc ttcttgagct ggactcattg tcgggccctg ccccttccca gtggtggtga tgaagatgat ttgtctgagg aagacctcca gtttgcagag cgctacctga gatcatacta ccatcctaca aatctcgcgg gaatcctgaa ggagaatgca gcaagctcca tgactgagag gctccgagaa atgcagtctt tcttcggctt agaggtgact ggcaaacttg acgataacac cttagatgtc atgaaaaagc caagatgcgg ggttcctgat gtgggtgaat acaatgtttt ccctcgaact cttaaatggt ccaaaatgaa tttaacctac agaattgtga attacacccc tgatatgact cattctgaag tcgaaaaggc attcaaaaaa gccttcaaag tttggtccga tgtaactcct ctgaatttta ccagacttca cgatggcatt gctgacatca tgatctcttt tggaattaag gagcatggcg acttctaccc atttgatggg ccctctggcc tgctggctca tgcttttcct cctgggccaa attatggagg agatgcccat tttgatgatg atgaaacctg gacaagtagt tccaaaggct acaacttgtt tcttgttgct gcgcatgagt tcggccactc cttaggtctt gaccactcca aggaccctgg agcactcatg tttcctatct acacctacac cggcaaaagc cactttatgc ttcctgatga cgatgtacaa gggatccagt ctctctatgg tccaggagat gaagacccca accctaaaca tccaaaaacg ccagacaaat gtgacccttc cttatccctt gatgccatta ccagtctccg aggagaaaca atgatcttta aagacagatt cttctggcgc ctgcatcctc agcaggttga tgcggagctg tttttaacga aatcattttg gccagaactt cccaaccgta ttgatgctgc atatgagcac ccttctcatg acctcatctt catcttcaga ggtagaaaat tttgggctct taatggttat gacattctgg aaggttatcc caaaaaaata tctgaactgg gtcttccaaa agaagttaag aagataagtg cagctgttca ctttgaggat acaggcaaga ctctcctgtt ctcaggaaac caggtctgga gatatgatga tactaaccat attatggata aagactatcc gagactaata gaagaagact tcccaggaat tggtgataaa gtagatgctg tctatgagaa aaatggttat atctattttt tcaacggacc catacagttt gaatacagca tctggagtaa ccgtattgtt cgcgtcatgc cagcaaattc cattttgtgg tgttaa. It is sometimes possible for the material contained within the vial of "MMP13, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.