MFSD7 cdna clone
MFSD7 cDNA Clone
Gene Names
MFSD7; LP2561
Synonyms
MFSD7; MFSD7 cDNA Clone; MFSD7 cdna clone
Sequence
atggcggggccgacggaggccgagacggggttggccgagccccgggccctgtgcgcgcagcggggccaccgcacctacgcgcgccgctgggtgttcctgctcgcgatcagcctgctcaactgctccaacgccacgctgtggctcagctttgcacctgtggctgacgtcattgctgaggacttggtcctgtccatggagcagatcaactggctgtcactggtctacctcgtggtatccaccccatttggcgtggcggccatctggatcctggactccgtcgggctccgtgcggcgaccatcctgggtgcgtggctgaactttgccgggagtgtgctacgcatggtgccctgcatggttgttgggacccaaaacccatttgccttcctcatgggtggccagagcctctgtgcccttgcccagagcctggtcatcttctctccagccaagctggctgccttgtggttcccagagcaccagcgagccacggccaacatgctcgccaccatgtcgaaccctctgggcgtccttgtggccaatgtgctgtcccctgtgctggtcaagaagggtgaggacattccgttaatgctcggtgtctataccatccctgctggcgtcgtctgcctgctgtccaccatctgcctgtgggagagtgtgccccccaccccgccctctgccggggctgccagctccacctcagagaagttcctggatgggctcaagctgctcatgtggaacaaggcctatgtcatcctggctgtgtgcttggggggaatgatcgggatctctgccagcttctcagccctcctggagcagatcctctgtgcaagcggccactccagtgggttttccggcctctgtggcgctctcttcatcacgtttgggatcctgggggcactggctctcggcccctatgtggaccggaccaagcacttcactgaggccaccaagattggcctgtgcctgttctctctggcctgcgtgccctttgccctggtgtcccagctgcagggacagacccttgccctggctgccacctgctcgctgctcgggctgtttggcttctcggtgggccccgtggccatggagttggcggtcgagtgttccttccccgtgggggagggggctgccacaggcatgatctttgtgctggggcaggccgagggaatactcatcatgctggcaatgacggcactgactgtgcgacgctcggagccgtccttgtccacctgccagcagggggaggatccacttgactggacagtgtctctgctgctgatggccggcctgtgcaccttcttcagctgcatcctggcggtcttcttccacaccccataccggcgcctgcaggccgagtctggggagcccccctccacccgtaacgccgtgggcggcgcagactcagggccgggtgtggaccgagggggagcaggaagggctggggtcctggggcccagcacggcgactccggagtgcacggcgaggggggcctcgctagaggaccccagagggcccgggagcccccacccagcctgccaccgagcgactccccgtgcgcaaggcccagcagccaccgacgcgccctcccgccccggcagactcgcaggcagggtccaagcgtccaggtttattgacccggctgggtctcactcctccttctcctccccgtgggtgatcacgtag
Sequence Length
1680
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
45,719 Da
NCBI Official Full Name
Homo sapiens major facilitator superfamily domain containing 7, mRNA
NCBI Official Synonym Full Names
major facilitator superfamily domain containing 7
NCBI Official Symbol
MFSD7
NCBI Official Synonym Symbols
LP2561
NCBI Protein Information
major facilitator superfamily domain-containing protein 7
UniProt Protein Name
Major facilitator superfamily domain-containing protein 7
Protein Family
UniProt Gene Name
MFSD7
UniProt Synonym Gene Names
MYL5
UniProt Entry Name
MFSD7_HUMAN
Uniprot Description
MFSD7: Belongs to the major facilitator superfamily. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, integral; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 4p16.3
Similar Products
Product Notes
The MFSD7 mfsd7 (Catalog #AAA1267700) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggggc cgacggaggc cgagacgggg ttggccgagc cccgggccct gtgcgcgcag cggggccacc gcacctacgc gcgccgctgg gtgttcctgc tcgcgatcag cctgctcaac tgctccaacg ccacgctgtg gctcagcttt gcacctgtgg ctgacgtcat tgctgaggac ttggtcctgt ccatggagca gatcaactgg ctgtcactgg tctacctcgt ggtatccacc ccatttggcg tggcggccat ctggatcctg gactccgtcg ggctccgtgc ggcgaccatc ctgggtgcgt ggctgaactt tgccgggagt gtgctacgca tggtgccctg catggttgtt gggacccaaa acccatttgc cttcctcatg ggtggccaga gcctctgtgc ccttgcccag agcctggtca tcttctctcc agccaagctg gctgccttgt ggttcccaga gcaccagcga gccacggcca acatgctcgc caccatgtcg aaccctctgg gcgtccttgt ggccaatgtg ctgtcccctg tgctggtcaa gaagggtgag gacattccgt taatgctcgg tgtctatacc atccctgctg gcgtcgtctg cctgctgtcc accatctgcc tgtgggagag tgtgcccccc accccgccct ctgccggggc tgccagctcc acctcagaga agttcctgga tgggctcaag ctgctcatgt ggaacaaggc ctatgtcatc ctggctgtgt gcttgggggg aatgatcggg atctctgcca gcttctcagc cctcctggag cagatcctct gtgcaagcgg ccactccagt gggttttccg gcctctgtgg cgctctcttc atcacgtttg ggatcctggg ggcactggct ctcggcccct atgtggaccg gaccaagcac ttcactgagg ccaccaagat tggcctgtgc ctgttctctc tggcctgcgt gccctttgcc ctggtgtccc agctgcaggg acagaccctt gccctggctg ccacctgctc gctgctcggg ctgtttggct tctcggtggg ccccgtggcc atggagttgg cggtcgagtg ttccttcccc gtgggggagg gggctgccac aggcatgatc tttgtgctgg ggcaggccga gggaatactc atcatgctgg caatgacggc actgactgtg cgacgctcgg agccgtcctt gtccacctgc cagcaggggg aggatccact tgactggaca gtgtctctgc tgctgatggc cggcctgtgc accttcttca gctgcatcct ggcggtcttc ttccacaccc cataccggcg cctgcaggcc gagtctgggg agcccccctc cacccgtaac gccgtgggcg gcgcagactc agggccgggt gtggaccgag ggggagcagg aagggctggg gtcctggggc ccagcacggc gactccggag tgcacggcga ggggggcctc gctagaggac cccagagggc ccgggagccc ccacccagcc tgccaccgag cgactccccg tgcgcaaggc ccagcagcca ccgacgcgcc ctcccgcccc ggcagactcg caggcagggt ccaagcgtcc aggtttattg acccggctgg gtctcactcc tccttctcct ccccgtgggt gatcacgtag. It is sometimes possible for the material contained within the vial of "MFSD7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
