MED24 cdna clone
MED24 cDNA Clone
Gene Names
MED24; MED5; CRSP4; ARC100; THRAP4; CRSP100; DRIP100; TRAP100
Synonyms
MED24; MED24 cDNA Clone; MED24 cdna clone
Sequence
atgaaggtggtcaacctgaagcaagccattttgcaagcctggaaggagcgctggagtgactaccaatgggcaatcaacatgaagaaattctttcctaaaggagccacctgggatattctcaacctggcagatgcgttactagagcaggccatgattggaccatcccccaatcctctcatcttgtcctacctgaagtatgccattagttcccagatggtgtcctactcttctgtcctcacagccatcagtaagtttgatgacttttctcgggacctgtgtgtccaggcattgctggacatcatggacatgttttgtgaccgtctgagctgtcacggcaaagcagaggaatgcatcggactgtgccgagcccttcttagcgccctccactggctgctgcgctgcacggcagcctctgcagagcggctgcgggaggggctggaggccggcactccagccgctggggagaagcagcttgccatgtgccttcagcgcctggagaaaaccctcagcagcaccaagaaccgggccctgctgcacatcgccaaactagaggaggcctcttcttggactgccatcgagcattctctcttgaaacttggagagatcctggccaatctcagcaacccgcagctccggagtcaggccgagcagtgtggcaccctcattaggagcatccccacgatgctgtctgtgcatgcggagcagatgcacaagaccggcttccccactgtccacgccgtgatcctgctcgagggcaccatgaacctgacaggcgagacgcagtccctggtggagcagctgacgatggtgaagcgcatgcagcatatccccaccccactttttgtcctggagatctggaaagcttgcttcgtggggctcattgagtctcccgagggtacggaggagctcaagtggacagctttcactttcctcaagattccacaggttttggtgaagttgaagaagtactctcatggagacaaggacttcactgaggatgtcaactgtgcttttgagttcctgctgaagctcacccccttgttggacaaagctgaccagcgctgcaactgtgactgtacaaacttcctgctccaagaatgtggcaagcaggggcttctgtctgaggccagcgtcaacaaccttatggctaagcgcaaagcagaccgagagcacgcaccccagcagaaatcgggagagaatgccaacatccagcccaacatccagctgatcctccgggcggagcccactgtcacaaacatcctcaagacgatggatgcagaccactctaagtcaccggagggactgctgggagtcctgggccacatgctgtccgggaagagtctggacttgctgctggctgccgccgccgccactggaaagctgaaatccttcgcccggaaattcatcaatttgaatgaattcacaacctatggcagcgaagaaagcaccaaaccggcctccgtccgggccctgctgtttgacatctccttcctcatgctgtgccatgtggcccagacctatggttcagaggtgattctgtccgagtcgcgcacaggagctgaggtgcccttcttcgagacctggatgcagacctgcatgcctgaggagggcaagatcctgaaccctgaccacccctgcttccgccccgactccaccaaagtggagtccctggtggccctgctcaacaactcctcggagatgaagctagtgcagatgaagtggcatgaggcctgtctcagcatctcagccgccatcttggaaatcctcaatgcctgggagaatggggtcctggccttcgagtccatccagaaaatcactgataacatcaaagggaaggtatgcagtctggcggtgtgtgctgtggcttggcttgtggcccacgtccggatgctggggctggatgagcgtgagaagtcgctgcagatgatccgccagctggcagggccactgtttagtgagaacaccctgcagttctacaatgagagggtggtgatcatgaactcgatcctggagcgcatgtgtgccgacgtgctgcagcagacagccacgcagatcaagtttccctccaccggggtggacacaatgccctactggaacctgctgccccccaagcggcccatcaaagaggtgctgacggacatttttgccaaggtgctggagaagggctgggtggacagccgctccatccacatctttgacaccctgctgcacatgggcggcgtctactggttctgcaacaacctgattaaggagctgctgaaggagacgcggaaggagcacacgctgcgggcagtggagctgctctactccatcttctgcctggacatgcagcaagtgaccctggtcctgctgggccacatcctacctggcctgctcactgactcctccaagtggcacagcctcatggaccccccgggcactgctcttgccaagctggccgtgtggtgtgccctcagttcctactcctcccacaagggacaggcgtccacccgccagaagaagagacaccgcgaagacattgaggattatatcagcctcttccccctggacgatgtgcagccttcgaagttgatgcgactgctgagctctaatgaggacgatgccaacatcctttcgagccccacagaccgatccatgagcagctccctctcagcctctcagctccacacggtcaacatgcgggaccctctgaaccgagtcctggccaacctgttcctgctcatctcctccatcctggggtctcgcaccgctggcccccacacccagttcgtgcagtggttcatggaggagtgtgtggactgcctggagcagggtggccgtggcagcgtcctgcagttcatgcccttcaccaccgtgtcggaactggtgaaggtgtcagccatgtctagccccaaggtggttctggccatcacggacctcagcctgcccctgggccgccaggtggctgctaaagccattgctgcactctga
Sequence Length
2970
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
108,938 Da
NCBI Official Full Name
Homo sapiens mediator complex subunit 24, mRNA
NCBI Official Synonym Full Names
mediator complex subunit 24
NCBI Official Symbol
MED24
NCBI Official Synonym Symbols
MED5; CRSP4; ARC100; THRAP4; CRSP100; DRIP100; TRAP100
NCBI Protein Information
mediator of RNA polymerase II transcription subunit 24
UniProt Protein Name
Mediator of RNA polymerase II transcription subunit 24
Protein Family
UniProt Gene Name
MED24
UniProt Synonym Gene Names
ARC100; CRSP4; DRIP100; KIAA0130; THRAP4; TRAP100; ARC100; CRSP complex subunit 4; Trap100; hTRAP100; DRIP100
UniProt Entry Name
MED24_HUMAN
NCBI Description
This gene encodes a component of the mediator complex (also known as TRAP, SMCC, DRIP, or ARC), a transcriptional coactivator complex thought to be required for the expression of almost all genes. The mediator complex is recruited by transcriptional activators or nuclear receptors to induce gene expression, possibly by interacting with RNA polymerase II and promoting the formation of a transcriptional pre-initiation complex. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Uniprot Description
Trap100: a transcriptional coactivator protein of the thyroid hormone receptor-associated protein (TRAP) family. Forms a complex with the thyroid hormone receptor (TR) and markedly enhance TR-mediated transcription in vitro. Interacts and co-precipitates with Trap220 but does not directly bind nuclear hormone receptors.
Protein type: Transcription, coactivator/corepressor; Nuclear receptor co-regulator
Chromosomal Location of Human Ortholog: 17q21.1
Cellular Component: nucleoplasm; nucleus; Srb-mediator complex
Molecular Function: protein binding; receptor activity; thyroid hormone receptor binding; transcription cofactor activity
Biological Process: androgen receptor signaling pathway; positive regulation of transcription, DNA-dependent; steroid hormone receptor signaling pathway; transcription initiation from RNA polymerase II promoter
Research Articles on MED24
Similar Products
Product Notes
The MED24 med24 (Catalog #AAA1270176) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaggtgg tcaacctgaa gcaagccatt ttgcaagcct ggaaggagcg ctggagtgac taccaatggg caatcaacat gaagaaattc tttcctaaag gagccacctg ggatattctc aacctggcag atgcgttact agagcaggcc atgattggac catcccccaa tcctctcatc ttgtcctacc tgaagtatgc cattagttcc cagatggtgt cctactcttc tgtcctcaca gccatcagta agtttgatga cttttctcgg gacctgtgtg tccaggcatt gctggacatc atggacatgt tttgtgaccg tctgagctgt cacggcaaag cagaggaatg catcggactg tgccgagccc ttcttagcgc cctccactgg ctgctgcgct gcacggcagc ctctgcagag cggctgcggg aggggctgga ggccggcact ccagccgctg gggagaagca gcttgccatg tgccttcagc gcctggagaa aaccctcagc agcaccaaga accgggccct gctgcacatc gccaaactag aggaggcctc ttcttggact gccatcgagc attctctctt gaaacttgga gagatcctgg ccaatctcag caacccgcag ctccggagtc aggccgagca gtgtggcacc ctcattagga gcatccccac gatgctgtct gtgcatgcgg agcagatgca caagaccggc ttccccactg tccacgccgt gatcctgctc gagggcacca tgaacctgac aggcgagacg cagtccctgg tggagcagct gacgatggtg aagcgcatgc agcatatccc caccccactt tttgtcctgg agatctggaa agcttgcttc gtggggctca ttgagtctcc cgagggtacg gaggagctca agtggacagc tttcactttc ctcaagattc cacaggtttt ggtgaagttg aagaagtact ctcatggaga caaggacttc actgaggatg tcaactgtgc ttttgagttc ctgctgaagc tcaccccctt gttggacaaa gctgaccagc gctgcaactg tgactgtaca aacttcctgc tccaagaatg tggcaagcag gggcttctgt ctgaggccag cgtcaacaac cttatggcta agcgcaaagc agaccgagag cacgcacccc agcagaaatc gggagagaat gccaacatcc agcccaacat ccagctgatc ctccgggcgg agcccactgt cacaaacatc ctcaagacga tggatgcaga ccactctaag tcaccggagg gactgctggg agtcctgggc cacatgctgt ccgggaagag tctggacttg ctgctggctg ccgccgccgc cactggaaag ctgaaatcct tcgcccggaa attcatcaat ttgaatgaat tcacaaccta tggcagcgaa gaaagcacca aaccggcctc cgtccgggcc ctgctgtttg acatctcctt cctcatgctg tgccatgtgg cccagaccta tggttcagag gtgattctgt ccgagtcgcg cacaggagct gaggtgccct tcttcgagac ctggatgcag acctgcatgc ctgaggaggg caagatcctg aaccctgacc acccctgctt ccgccccgac tccaccaaag tggagtccct ggtggccctg ctcaacaact cctcggagat gaagctagtg cagatgaagt ggcatgaggc ctgtctcagc atctcagccg ccatcttgga aatcctcaat gcctgggaga atggggtcct ggccttcgag tccatccaga aaatcactga taacatcaaa gggaaggtat gcagtctggc ggtgtgtgct gtggcttggc ttgtggccca cgtccggatg ctggggctgg atgagcgtga gaagtcgctg cagatgatcc gccagctggc agggccactg tttagtgaga acaccctgca gttctacaat gagagggtgg tgatcatgaa ctcgatcctg gagcgcatgt gtgccgacgt gctgcagcag acagccacgc agatcaagtt tccctccacc ggggtggaca caatgcccta ctggaacctg ctgcccccca agcggcccat caaagaggtg ctgacggaca tttttgccaa ggtgctggag aagggctggg tggacagccg ctccatccac atctttgaca ccctgctgca catgggcggc gtctactggt tctgcaacaa cctgattaag gagctgctga aggagacgcg gaaggagcac acgctgcggg cagtggagct gctctactcc atcttctgcc tggacatgca gcaagtgacc ctggtcctgc tgggccacat cctacctggc ctgctcactg actcctccaa gtggcacagc ctcatggacc ccccgggcac tgctcttgcc aagctggccg tgtggtgtgc cctcagttcc tactcctccc acaagggaca ggcgtccacc cgccagaaga agagacaccg cgaagacatt gaggattata tcagcctctt ccccctggac gatgtgcagc cttcgaagtt gatgcgactg ctgagctcta atgaggacga tgccaacatc ctttcgagcc ccacagaccg atccatgagc agctccctct cagcctctca gctccacacg gtcaacatgc gggaccctct gaaccgagtc ctggccaacc tgttcctgct catctcctcc atcctggggt ctcgcaccgc tggcccccac acccagttcg tgcagtggtt catggaggag tgtgtggact gcctggagca gggtggccgt ggcagcgtcc tgcagttcat gcccttcacc accgtgtcgg aactggtgaa ggtgtcagcc atgtctagcc ccaaggtggt tctggccatc acggacctca gcctgcccct gggccgccag gtggctgcta aagccattgc tgcactctga. It is sometimes possible for the material contained within the vial of "MED24, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
