Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MED16 cdna clone

MED16 cDNA Clone

Gene Names
MED16; DRIP92; THRAP5; TRAP95
Synonyms
MED16; MED16 cDNA Clone; MED16 cdna clone
Ordering
For Research Use Only!
Sequence
atgtgtgatttgcggcggccagcggcaggtgggatgatggacttggcctacgtctgtgagtgggagaaatggtccaagagcacccactgcccatcggtgcccctggcctgcgcctggtcctgccgaaatctcatcgccttcaccatggacctgcgcagcgatgaccaggacctgacccgcatgatccacatcctggacacggagcacccctgggacctgcactcgatcccctcagagcaccacgaggctatcacctgcctggagtgggaccagtcaggctcccggctcctgtcagcagatgccgacgggcagatcaagtgctggagcatggcggaccacctggctaatagctgggagagctcagtgggcagcctagtggagggggaccccattgtggccctgtcctggctgcacaatggtgtgaaactggccctgcacgtggagaagtcgggcgcctccagcttcggggagaagttctcccgagtcaagttctcaccgtcgctcacgctgttcggcggcaagcccatggagggctggatcgcggtgacggtcagcggcctggtcaccgtgtccctgctgaagcccagcgggcaggtgctgacgtccaccgagagcctgtgccggctgcgcggccgcgtggccctggccgacatcgccttcaccggcggcggcaacatcgtggtggccacggcggacggcagcagcgcgtcgcccgtgcagttctacaaggtgtgcgtgagcgtggtgagcgagaagtgccgtatcgacacggagatcctgccctccctgttcatgcgctgcaccaccgacctcaaccgcaaggacaagttccccgccatcacccacctcaagttcctggcccgggacatgtcggagcaggtgcttttgtgcgcgtccagccagaccagcagcatcgtggagtgctggtccctgcgcaaggagggactccccgtgaacaacatcttccagcagatctcccccgtggttggcgacaaacagcccacaattctcaaatggcggatcctatcggccaccaacgatctggaccgtgtgtcggccgtggcgctgcccaagctgcccatctcgctcaccaacaccgacctcaaggtggccagcgacacacagttctaccctggcctcgggctggccctggccttccacgacggcagcgtccacatcgtgcaccggctctcactgcagaccatggccgtcttctacagctccgcggccccgaggcctgtggatgagccggccatgaagcgcccccgcaccgcgggccccgccgtccacttaaaggctatgcagctatcgtggacgtcactggccctggtggggattgacagccacgggaagctgagcgtgctccgcctctcaccttccatgggccacccgctggaggtggggctggcgctgcggcacctgctcttcctgctggagtactgcatggtgaccggctacgactggtgggacatcctgctgcacgtgcagcccagtatggtacagagcctggtggagaagctgcacgaggagtacacgcgccagaccgctgccctgcagcaggtcctctccacccggatcctggccatgaaggcctcgctctgcaagctgtcgccctgcacggtgactcgcgtgtgcgactaccacaccaagctcttcctcatcgccatcagctccaccctgaagtcgctgctgcgcccccactttctcaacacgcctgacaagagccccggcgaccggctgaccgagatctgcaccaagatcaccgacgtcgacattgacaaggtcatgatcaacctcaagacggaggaatttgtgctggacatgaacacactgcaggcgctgcagcagctcttgcagtgggtgggcgacttcgtgctgtacctgctggccagcctacccaaccagggttccctgctgaggccgggccacagctttctgcgggacggcacctcgctgggcatgcttcgggaattgatggtggtcatccgcatctggggccttctgaagcccagctgcctgcccgtgtatacggccacttcggatacccaggacagcatgtccctgctcttccgcctgctcaccaagctctggatctgctgtcgcgatgagggcccagcgagcgagccggacgaggcgctggtggatgaatgctgcctgctgcccagccagctgcttatccccagcctggactggctgccagccagcgacggcctggtcagccgcctgcagcccaagcagccccttcgtctgcagtttggccgggcgcccacgctgcctggcagtgctgccaccctgcagctcgacggcctcgccagggccccaggccagcccaagatcgaccacctgcggaggctgcaccttggcgcttgccccacggaggaatgcaaggcctgcaccaggtgcggctgtgtcaccatgctcaagtcgcccaacagaaccacggcggtgaagcagtgggagcagcgctggatcaagaactgcctgtgcggtgggctctggtggcgggtgcccctcagctacccctga
Sequence Length
2526
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
72,967 Da
NCBI Official Full Name
Homo sapiens mediator complex subunit 16, mRNA
NCBI Official Synonym Full Names
mediator complex subunit 16
NCBI Official Symbol
MED16
NCBI Official Synonym Symbols
DRIP92; THRAP5; TRAP95
NCBI Protein Information
mediator of RNA polymerase II transcription subunit 16
UniProt Protein Name
Mediator of RNA polymerase II transcription subunit 16
UniProt Gene Name
MED16
UniProt Synonym Gene Names
; Trap95; DRIP92
UniProt Entry Name
MED16_HUMAN

Uniprot Description

MED16: Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery. Mediator is recruited to promoters by direct interactions with regulatory proteins and serves as a scaffold for the assembly of a functional preinitiation complex with RNA polymerase II and the general transcription factors. Belongs to the Mediator complex subunit 16 family. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Nuclear receptor co-regulator; Receptor, misc.; Transcription, coactivator/corepressor

Chromosomal Location of Human Ortholog: 19p13.3

Cellular Component: membrane; nucleoplasm; Srb-mediator complex

Molecular Function: protein binding; receptor activity; thyroid hormone receptor binding; thyroid hormone receptor coactivator activity; transcription coactivator activity; transcription cofactor activity

Biological Process: androgen receptor signaling pathway; positive regulation of transcription, DNA-dependent; steroid hormone receptor signaling pathway; transcription from RNA polymerase II promoter; transcription initiation from RNA polymerase II promoter

Similar Products

Product Notes

The MED16 med16 (Catalog #AAA1266559) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtgtgatt tgcggcggcc agcggcaggt gggatgatgg acttggccta cgtctgtgag tgggagaaat ggtccaagag cacccactgc ccatcggtgc ccctggcctg cgcctggtcc tgccgaaatc tcatcgcctt caccatggac ctgcgcagcg atgaccagga cctgacccgc atgatccaca tcctggacac ggagcacccc tgggacctgc actcgatccc ctcagagcac cacgaggcta tcacctgcct ggagtgggac cagtcaggct cccggctcct gtcagcagat gccgacgggc agatcaagtg ctggagcatg gcggaccacc tggctaatag ctgggagagc tcagtgggca gcctagtgga gggggacccc attgtggccc tgtcctggct gcacaatggt gtgaaactgg ccctgcacgt ggagaagtcg ggcgcctcca gcttcgggga gaagttctcc cgagtcaagt tctcaccgtc gctcacgctg ttcggcggca agcccatgga gggctggatc gcggtgacgg tcagcggcct ggtcaccgtg tccctgctga agcccagcgg gcaggtgctg acgtccaccg agagcctgtg ccggctgcgc ggccgcgtgg ccctggccga catcgccttc accggcggcg gcaacatcgt ggtggccacg gcggacggca gcagcgcgtc gcccgtgcag ttctacaagg tgtgcgtgag cgtggtgagc gagaagtgcc gtatcgacac ggagatcctg ccctccctgt tcatgcgctg caccaccgac ctcaaccgca aggacaagtt ccccgccatc acccacctca agttcctggc ccgggacatg tcggagcagg tgcttttgtg cgcgtccagc cagaccagca gcatcgtgga gtgctggtcc ctgcgcaagg agggactccc cgtgaacaac atcttccagc agatctcccc cgtggttggc gacaaacagc ccacaattct caaatggcgg atcctatcgg ccaccaacga tctggaccgt gtgtcggccg tggcgctgcc caagctgccc atctcgctca ccaacaccga cctcaaggtg gccagcgaca cacagttcta ccctggcctc gggctggccc tggccttcca cgacggcagc gtccacatcg tgcaccggct ctcactgcag accatggccg tcttctacag ctccgcggcc ccgaggcctg tggatgagcc ggccatgaag cgcccccgca ccgcgggccc cgccgtccac ttaaaggcta tgcagctatc gtggacgtca ctggccctgg tggggattga cagccacggg aagctgagcg tgctccgcct ctcaccttcc atgggccacc cgctggaggt ggggctggcg ctgcggcacc tgctcttcct gctggagtac tgcatggtga ccggctacga ctggtgggac atcctgctgc acgtgcagcc cagtatggta cagagcctgg tggagaagct gcacgaggag tacacgcgcc agaccgctgc cctgcagcag gtcctctcca cccggatcct ggccatgaag gcctcgctct gcaagctgtc gccctgcacg gtgactcgcg tgtgcgacta ccacaccaag ctcttcctca tcgccatcag ctccaccctg aagtcgctgc tgcgccccca ctttctcaac acgcctgaca agagccccgg cgaccggctg accgagatct gcaccaagat caccgacgtc gacattgaca aggtcatgat caacctcaag acggaggaat ttgtgctgga catgaacaca ctgcaggcgc tgcagcagct cttgcagtgg gtgggcgact tcgtgctgta cctgctggcc agcctaccca accagggttc cctgctgagg ccgggccaca gctttctgcg ggacggcacc tcgctgggca tgcttcggga attgatggtg gtcatccgca tctggggcct tctgaagccc agctgcctgc ccgtgtatac ggccacttcg gatacccagg acagcatgtc cctgctcttc cgcctgctca ccaagctctg gatctgctgt cgcgatgagg gcccagcgag cgagccggac gaggcgctgg tggatgaatg ctgcctgctg cccagccagc tgcttatccc cagcctggac tggctgccag ccagcgacgg cctggtcagc cgcctgcagc ccaagcagcc ccttcgtctg cagtttggcc gggcgcccac gctgcctggc agtgctgcca ccctgcagct cgacggcctc gccagggccc caggccagcc caagatcgac cacctgcgga ggctgcacct tggcgcttgc cccacggagg aatgcaaggc ctgcaccagg tgcggctgtg tcaccatgct caagtcgccc aacagaacca cggcggtgaa gcagtgggag cagcgctgga tcaagaactg cctgtgcggt gggctctggt ggcgggtgcc cctcagctac ccctga. It is sometimes possible for the material contained within the vial of "MED16, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.