MED15 cdna clone
MED15 cDNA Clone
Gene Names
MED15; TIG1; CAG7A; CTG7A; PCQAP; TIG-1; TNRC7; ARC105
Synonyms
MED15; MED15 cDNA Clone; MED15 cdna clone
Sequence
atggacgtttccgggcaagagaccgactggcggagcaccgccttccggcagaagctggtcagtcaaatcgaggatgccatgaggaaagctggtgtggcacacagtaaatccagcaaggatatggagagccatgttttcctgaaggccaagacccgggacgaatacctttctctcgtggccaggctcattatccattttcgagacattcataacaagaaatctcaagcttccgtcagtgatcctatgaatgcactccagagcctgactggcggacctgctgcgggagccgctggaattggcatgcctcctcggggcccgggacagtctctgggcgggatgggtagccttggtgccatgggacagccaatgtctctctcagggcagccgcctcctgggacctcggggatggcccctcacagcatggctgtcgtgtctacggcaactccacagacccagctgcagctccagcaggtggcgctgcagcagcagcagcaacagcagcagttccagcagcagcagcaggcggcgctacagcagcagcagcagcagcagcaacagcagcagttccaggctcagcagagtgccatgcagcagcagttccaagcagtagtgcagcagcagcagcagctccagcagcagcagcagcagcagcagcatctaattaaattgcatcatcaaaatcagcaacagatacagcagcagcaacagcagctgcagcgaatagcacagctgcagctccaacaacagcaacagcagcagcagcagcagcagcagcagcagcagcaggctttgcaggcccagccaccaattcagcagccaccgatgcagcagccacagcctccgccctcccaggctctgccccagcagctgcagcagatgcatcacacacagcaccaccagccgccaccacagccccagcagcctccagttgctcagaaccaaccatcacaactcccgccacagtcgcagacccagcctttggtgtcacaggcgcaagctctccctggacaaatgttgtatacccaaccaccactgaaatttgtccgagctccgatggtggtgcagcagcccccagtgcagccccaggtgcagcagcagcagacagcagtacagacagctcaggctgcccagatggtggctcccggagtccaggtcagccagagcagcctccccatgctgtcctcgccgtcaccgggccagcaggtgcagaccccgcagtcgatgccccctcccccccagccgtccccgcagcccggccagcccagctcacagcccaactccaacgtcagctctggccctgccccatctcccagtagcttcctgcccagcccctcaccgcagccctcccagagcccagtgacggcgcggaccccacagaacttcagtgtcccctcacctggacctttaaacacacctgtgaaccccagctctgtcatgagcccagctggctccagccaggctgaggagcagcagtacctggacaagctgaagcagctgtcgaagtacatcgagcccctgcgccgcatgatcaacaagatcgacaagaacgaagacagaaaaaaggacctgagtaagatgaagagccttctggacattctgacagacccctcgaagcggtgtcccctgaagaccttgcaaaagtgtgagatcgccctggagaaactcaagaatgacatggcggtgcccactcccccaccgcccccggtgccaccgaccaaacagcagtacctatgccagccgctcctggatgccgtcctggccaacatccgctcacctgtcttcaaccattccctgtaccgcacattcgttccagccatgaccgccattcacggcccacccatcacggccccagtggtgtgcacccggaagcgcaggcttgaggatgatgagcggcagagcatccccagtgtgctccagggtgaggtggccaggctggaccccaagttcctggtaaacctggacccttctcactgcagcaacaatggcactgtccacctgatctgcaagctggatgacaaggacctcccaagtgtgccaccactggagctcagtgtgcccgctgactatcctgcccaaagcccgctgtggatagaccggcagtggcagtacgacgccaaccccttcctccagtcggtgcaccgctgcatgacctccaggctgctgcagctcccggacaagcactcggtcaccgccttgctcaacacctgggcccagagcgtccaccaggcctgcctctcagccgcctag
Sequence Length
2247
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
75,927 Da
NCBI Official Full Name
Homo sapiens mediator complex subunit 15, mRNA
NCBI Official Synonym Full Names
mediator complex subunit 15
NCBI Official Symbol
MED15
NCBI Official Synonym Symbols
TIG1; CAG7A; CTG7A; PCQAP; TIG-1; TNRC7; ARC105
NCBI Protein Information
mediator of RNA polymerase II transcription subunit 15
UniProt Protein Name
Mediator of RNA polymerase II transcription subunit 15
Protein Family
UniProt Gene Name
MED15
UniProt Synonym Gene Names
ARC105; CTG7A; PCQAP; TIG1; TNRC7; ARC105; PC2 glutamine/Q-rich-associated protein; TIG-1
UniProt Entry Name
MED15_HUMAN
NCBI Description
The protein encoded by this gene is a subunit of the multiprotein complexes PC2 and ARC/DRIP and may function as a transcriptional coactivator in RNA polymerase II transcription. This gene contains stretches of trinucleotide repeats and is located in the chromosome 22 region which is deleted in DiGeorge syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Uniprot Description
PCQAP: Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery. Mediator is recruited to promoters by direct interactions with regulatory proteins and serves as a scaffold for the assembly of a functional preinitiation complex with RNA polymerase II and the general transcription factors. Required for cholesterol-dependent gene regulation. Positively regulates the Nodal signaling pathway. Belongs to the Mediator complex subunit 15 family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Transcription, coactivator/corepressor; Nuclear receptor co-regulator
Chromosomal Location of Human Ortholog: 22q11.2
Cellular Component: membrane; nucleoplasm; nucleus
Molecular Function: protein binding
Biological Process: transcription initiation from RNA polymerase II promoter
Research Articles on MED15
Similar Products
Product Notes
The MED15 med15 (Catalog #AAA1265784) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacgttt ccgggcaaga gaccgactgg cggagcaccg ccttccggca gaagctggtc agtcaaatcg aggatgccat gaggaaagct ggtgtggcac acagtaaatc cagcaaggat atggagagcc atgttttcct gaaggccaag acccgggacg aatacctttc tctcgtggcc aggctcatta tccattttcg agacattcat aacaagaaat ctcaagcttc cgtcagtgat cctatgaatg cactccagag cctgactggc ggacctgctg cgggagccgc tggaattggc atgcctcctc ggggcccggg acagtctctg ggcgggatgg gtagccttgg tgccatggga cagccaatgt ctctctcagg gcagccgcct cctgggacct cggggatggc ccctcacagc atggctgtcg tgtctacggc aactccacag acccagctgc agctccagca ggtggcgctg cagcagcagc agcaacagca gcagttccag cagcagcagc aggcggcgct acagcagcag cagcagcagc agcaacagca gcagttccag gctcagcaga gtgccatgca gcagcagttc caagcagtag tgcagcagca gcagcagctc cagcagcagc agcagcagca gcagcatcta attaaattgc atcatcaaaa tcagcaacag atacagcagc agcaacagca gctgcagcga atagcacagc tgcagctcca acaacagcaa cagcagcagc agcagcagca gcagcagcag cagcaggctt tgcaggccca gccaccaatt cagcagccac cgatgcagca gccacagcct ccgccctccc aggctctgcc ccagcagctg cagcagatgc atcacacaca gcaccaccag ccgccaccac agccccagca gcctccagtt gctcagaacc aaccatcaca actcccgcca cagtcgcaga cccagccttt ggtgtcacag gcgcaagctc tccctggaca aatgttgtat acccaaccac cactgaaatt tgtccgagct ccgatggtgg tgcagcagcc cccagtgcag ccccaggtgc agcagcagca gacagcagta cagacagctc aggctgccca gatggtggct cccggagtcc aggtcagcca gagcagcctc cccatgctgt cctcgccgtc accgggccag caggtgcaga ccccgcagtc gatgccccct cccccccagc cgtccccgca gcccggccag cccagctcac agcccaactc caacgtcagc tctggccctg ccccatctcc cagtagcttc ctgcccagcc cctcaccgca gccctcccag agcccagtga cggcgcggac cccacagaac ttcagtgtcc cctcacctgg acctttaaac acacctgtga accccagctc tgtcatgagc ccagctggct ccagccaggc tgaggagcag cagtacctgg acaagctgaa gcagctgtcg aagtacatcg agcccctgcg ccgcatgatc aacaagatcg acaagaacga agacagaaaa aaggacctga gtaagatgaa gagccttctg gacattctga cagacccctc gaagcggtgt cccctgaaga ccttgcaaaa gtgtgagatc gccctggaga aactcaagaa tgacatggcg gtgcccactc ccccaccgcc cccggtgcca ccgaccaaac agcagtacct atgccagccg ctcctggatg ccgtcctggc caacatccgc tcacctgtct tcaaccattc cctgtaccgc acattcgttc cagccatgac cgccattcac ggcccaccca tcacggcccc agtggtgtgc acccggaagc gcaggcttga ggatgatgag cggcagagca tccccagtgt gctccagggt gaggtggcca ggctggaccc caagttcctg gtaaacctgg acccttctca ctgcagcaac aatggcactg tccacctgat ctgcaagctg gatgacaagg acctcccaag tgtgccacca ctggagctca gtgtgcccgc tgactatcct gcccaaagcc cgctgtggat agaccggcag tggcagtacg acgccaaccc cttcctccag tcggtgcacc gctgcatgac ctccaggctg ctgcagctcc cggacaagca ctcggtcacc gccttgctca acacctgggc ccagagcgtc caccaggcct gcctctcagc cgcctag. It is sometimes possible for the material contained within the vial of "MED15, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
