Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MCOLN3 cdna clone

MCOLN3 cDNA Clone

Gene Names
MCOLN3; TRPML3; TRP-ML3
Synonyms
MCOLN3; MCOLN3 cDNA Clone; MCOLN3 cdna clone
Ordering
For Research Use Only!
Sequence
atggcagatcctgaggtagttgtgagtagctgcagctctcatgaagaggaaaatcgctgcaattttaaccagcaaacatctccatctgaggagcttctattagaagaccagatgaggcgaaaactcaaattttttttcatgaatccctgtgagaagttctgggctcgaggtagaaaaccatggaaacttgccatacaaattctaaaaattgcaatggtgactatccagctggtcttatttgggctaagtaaccagatggtggtagctttcaaggaagagaatactatagcattcaaacaccttttcctaaaaggatatatggaccgaatggatgacacatatgcagtgtacacacaaagtgacgtgtatgatcagttaatcttcgcagtaaaccagtacttgcagctatacaatgtctccgttgggaatcatgcttatgagaacaaaggtaccaagcaatctgctatggcaatctgtcagcacttatacaagcgaggaaacatctaccctggaaatgatacctttgacatcgatccagaaattgaaactgagtgtttctttgtggagccagatgaaccttttcacattgggacaccagcagaaaataaactgaacttaacactggacttccacagactcctaacagtggagcttcagtttaaactgaaagccattaatctgcagacagttcgtcatcaagaactccctgactgttatgactttactctgactataacatttgacaacaaggcccatagtggaagaattaaaataagtttagataatgacatttccatcagagaatgtaaagactggcatgtatctggatcaattcagaagaacactcattacatgatgatctttgatgcctttgtcattctgacttgcttggtttcattaatcctctgcattagatctgtgattagaggacttcagcttcagcaggtagggaacgttgctttctag
Sequence Length
966
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
57,723 Da
NCBI Official Full Name
Homo sapiens mucolipin 3, mRNA
NCBI Official Synonym Full Names
mucolipin 3
NCBI Official Symbol
MCOLN3
NCBI Official Synonym Symbols
TRPML3; TRP-ML3
NCBI Protein Information
mucolipin-3
UniProt Protein Name
Mucolipin-3
Protein Family
UniProt Gene Name
MCOLN3
UniProt Entry Name
MCLN3_HUMAN

NCBI Description

This gene encodes one of members of the mucolipin cation channel proteins. Mutation studies of the highly similar protein in mice have shown that the protein is found in cochlea hair cells, and mutant mice show early-onset hearing loss and balance problems. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]

Uniprot Description

MCOLN3: one of members of the mucolipin cation channel proteins. Mutation studies of the highly similar protein in mice have shown that the protein is found in cochlea hair cells, and mutant mice show early-onset hearing loss and balance problems. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]

Protein type: Membrane protein, multi-pass; Channel, cation; Membrane protein, integral

Chromosomal Location of Human Ortholog: 1p22.3

Cellular Component: plasma membrane

Molecular Function: calcium channel activity

Research Articles on MCOLN3

Similar Products

Product Notes

The MCOLN3 mcoln3 (Catalog #AAA1274567) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagatc ctgaggtagt tgtgagtagc tgcagctctc atgaagagga aaatcgctgc aattttaacc agcaaacatc tccatctgag gagcttctat tagaagacca gatgaggcga aaactcaaat tttttttcat gaatccctgt gagaagttct gggctcgagg tagaaaacca tggaaacttg ccatacaaat tctaaaaatt gcaatggtga ctatccagct ggtcttattt gggctaagta accagatggt ggtagctttc aaggaagaga atactatagc attcaaacac cttttcctaa aaggatatat ggaccgaatg gatgacacat atgcagtgta cacacaaagt gacgtgtatg atcagttaat cttcgcagta aaccagtact tgcagctata caatgtctcc gttgggaatc atgcttatga gaacaaaggt accaagcaat ctgctatggc aatctgtcag cacttataca agcgaggaaa catctaccct ggaaatgata cctttgacat cgatccagaa attgaaactg agtgtttctt tgtggagcca gatgaacctt ttcacattgg gacaccagca gaaaataaac tgaacttaac actggacttc cacagactcc taacagtgga gcttcagttt aaactgaaag ccattaatct gcagacagtt cgtcatcaag aactccctga ctgttatgac tttactctga ctataacatt tgacaacaag gcccatagtg gaagaattaa aataagttta gataatgaca tttccatcag agaatgtaaa gactggcatg tatctggatc aattcagaag aacactcatt acatgatgat ctttgatgcc tttgtcattc tgacttgctt ggtttcatta atcctctgca ttagatctgt gattagagga cttcagcttc agcaggtagg gaacgttgct ttctag. It is sometimes possible for the material contained within the vial of "MCOLN3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.