Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MCF2L cdna clone

MCF2L cDNA Clone

Gene Names
MCF2L; DBS; OST; ARHGEF14
Synonyms
MCF2L; MCF2L cDNA Clone; MCF2L cdna clone
Ordering
For Research Use Only!
Sequence
atgacggtgcgccggctgtcactgctgtgccgggacctctgggcgctgtggctgctgctgaaggccggcgcagatgaaatcatgcaccaggacatcgtcccgctctgtgctgccgacatccaggaccagctaaagaagcgctttgcttacctgtccggtgggcgggggcaggacggaagcccggttatcaccttccctgactacccggccttcagcgagattccggacaaggagttccagaatgtcatgacctacctcaccagcatccccagcctgcaggacgctggcatcggattcatcctggtgatagaccggcgacgggacaaatggacctccgtgaaggcgtccgtcctgcgcatcgcagcatctttcccggcaaacctgcagctcgtcctcgtgcttcgcccgacgggttttttccaaaggactctctccgacatcgctttcaaattcaatagagatgactttaagatgaaggtgccggtcataatgctgagctccgtaccagacttacacggttacatcgataagtcgcagctgaccgaggacctgggtgggaccctggactactgccactcccggtggctgtgccagcgcacggccatcgaaagtttcgccctcatggtgaagcagacggctcagatgctgcagtccttcgggaccgagctggctgaaacagagctgcccaatgacgtccagtcgacaagctcagtgctgtgtgcgcacacagagaagaaggacaaggcgaaggaggatttgaggctggcactgaaagaggggcacagtgtcctggagagcctcagggagctgcaggctgagggctcagagcccagtgtgaaccaggaccagcttgacaaccaggccaccgtgcagaggctcctggcccagctgaacgaaaccgaggctgccttcgatgagttctgggcaaagcatcagcagaaactggagcagtgtctgcagctccggcactttgagcagggcttccgggaggtcaaagccatcttggacgcagcgtcccagaagatagcaaccttcacagacatcggcaacagcctggcgcatgtggagcacctgctgagggacctggccagcttcgaggagaaatcaggcgtggccgtggagagggcccgggccctgtctctggacggcgagcagctcattgggaacaagcactacgcggtagactccatccgcccaaagtgccaggagctccggcacctctgtgaccagttctctgcggagatcgcaaggaggagggggctgctcagcaagtccctggagctgcaccgccgcctggagacgtccatgaagtggtgtgatgaagggatttacctgctggcctcacaacctgtggacaagtgccagtcccaggacggcgcggaggctgccctccaggaaatcgagaagtttttggagaccggtgcggaaaataagatccaggagctcaacgcgatttacaaggaatacgaatccatcctcaaccaagatctcatggagcacgtgcgaaaggtcttccagaagcaggcaagcatggaggaggtgttccaccgcaggcaggccagcctgaagaagctggcggccaggcagacgcggcccgtgcagccggtggcccccagacccgaggcactggcaaagtcgccctgcccctccccaggcattcggcgaggctctgagaactccagctccgagggcggtgcgctccggagagggccctaccggagggccaagagtgagatgagtgagagccggcagggccgcggctcagcgggggaggaggaggaaagcctggccatcctgcgcaggcacgtgatgagcgagctcctggacacagaacgggcctacgtggaggagctgctgtgcgtcctggagggctacgccgcggagatggataacccactgatggctcacctcctgtcaacaggccttcacaacaagaaggatgttttgtttggaaacatggaggaaatctatcacttccacaacaggatattcctcagggagctggaaaactacactgactgcccagaactggttggaagatgctttctggagaggatggaagatttccagatctatgagaagtactgtcagaacaagccccgctctgagagcctgtggagacagtgctccgactgcccgtttttccaggaatgccagagaaagctggaccacaagctgagcctggactcctacctgctgaagccagtgcagaggatcaccaagtaccagctgctgctcaaggaaatgctgaaatacagcaggaactgcgagggggctgaggacctgcaggaggcgctgagctccatcctgggcatcctgaaggccgtgaacgactccatgcacctcatcgctatcaccggctatgacgggaatctcggcgacctgggcaagctgctgatgcagggctcgttcagcgtctggaccgaccacaagaggggccacaccaaggtgaaggagctggccaggttcaagcccatgcagcggcacctgttcctgcacgagaaggcagtgctcttctgcaagaagagggaggagaatggggaggggtatgagaaagctccctcctacagctacaagcagtccttaaacatggctgccgttggcattacggagaacgtgaagggagatgctaagaagttcgagatctggtacaacgcgcgcgaggaggtctacatcgtccaggcgccaactcctgagattaaagccgcgtgggtgaatgaaattcggaaagtgctgaccagccagctgcaggcttgtagagaagccagccagcaccgggcgctggagcagtcacagagcctgcccctgccggccccgaccagcaccagtccctcaagaggaaactcaaggaacatcaagaagctggaagaaaggaaaacagaccccctaagcctggagggatacgtcagctcagcgccactgacaaagccccccgaaaagggcaaagagccctag
Sequence Length
2955
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
126,111 Da
NCBI Official Full Name
Homo sapiens MCF.2 cell line derived transforming sequence-like, mRNA
NCBI Official Synonym Full Names
MCF.2 cell line derived transforming sequence like
NCBI Official Symbol
MCF2L
NCBI Official Synonym Symbols
DBS; OST; ARHGEF14
NCBI Protein Information
guanine nucleotide exchange factor DBS
UniProt Protein Name
Guanine nucleotide exchange factor DBS
UniProt Gene Name
MCF2L
UniProt Entry Name
MCF2L_HUMAN

NCBI Description

This gene encodes a guanine nucleotide exchange factor that interacts specifically with the GTP-bound Rac1 and plays a role in the Rho/Rac signaling pathways. A variant in this gene was associated with osteoarthritis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]

Uniprot Description

ARHGEF14: Guanine nucleotide exchange factor that potentially links pathways that signal through RAC1, RHOA and CDC42. Catalyzes guanine nucleotide exchange on RHOA and CDC42 and interacts specifically with the GTP-bound form of RAC1, suggesting that it functions as an effector of RAC1. May also participate in axonal transport in the brain. Becomes activated and highly tumorigenic by truncation of the N-terminus. Isoform 5 activates CDC42. Belongs to the MCF2 family. 8 isoforms of the human protein are produced by alternative splicing.

Protein type: GEFs; Oncoprotein; GEFs, Rac/Rho

Chromosomal Location of Human Ortholog: 13q34

Cellular Component: cytosol; extracellular space

Molecular Function: guanyl-nucleotide exchange factor activity; phosphoinositide binding; Rho guanyl-nucleotide exchange factor activity

Biological Process: positive regulation of apoptosis; regulation of small GTPase mediated signal transduction

Research Articles on MCF2L

Similar Products

Product Notes

The MCF2L mcf2l (Catalog #AAA1275019) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacggtgc gccggctgtc actgctgtgc cgggacctct gggcgctgtg gctgctgctg aaggccggcg cagatgaaat catgcaccag gacatcgtcc cgctctgtgc tgccgacatc caggaccagc taaagaagcg ctttgcttac ctgtccggtg ggcgggggca ggacggaagc ccggttatca ccttccctga ctacccggcc ttcagcgaga ttccggacaa ggagttccag aatgtcatga cctacctcac cagcatcccc agcctgcagg acgctggcat cggattcatc ctggtgatag accggcgacg ggacaaatgg acctccgtga aggcgtccgt cctgcgcatc gcagcatctt tcccggcaaa cctgcagctc gtcctcgtgc ttcgcccgac gggttttttc caaaggactc tctccgacat cgctttcaaa ttcaatagag atgactttaa gatgaaggtg ccggtcataa tgctgagctc cgtaccagac ttacacggtt acatcgataa gtcgcagctg accgaggacc tgggtgggac cctggactac tgccactccc ggtggctgtg ccagcgcacg gccatcgaaa gtttcgccct catggtgaag cagacggctc agatgctgca gtccttcggg accgagctgg ctgaaacaga gctgcccaat gacgtccagt cgacaagctc agtgctgtgt gcgcacacag agaagaagga caaggcgaag gaggatttga ggctggcact gaaagagggg cacagtgtcc tggagagcct cagggagctg caggctgagg gctcagagcc cagtgtgaac caggaccagc ttgacaacca ggccaccgtg cagaggctcc tggcccagct gaacgaaacc gaggctgcct tcgatgagtt ctgggcaaag catcagcaga aactggagca gtgtctgcag ctccggcact ttgagcaggg cttccgggag gtcaaagcca tcttggacgc agcgtcccag aagatagcaa ccttcacaga catcggcaac agcctggcgc atgtggagca cctgctgagg gacctggcca gcttcgagga gaaatcaggc gtggccgtgg agagggcccg ggccctgtct ctggacggcg agcagctcat tgggaacaag cactacgcgg tagactccat ccgcccaaag tgccaggagc tccggcacct ctgtgaccag ttctctgcgg agatcgcaag gaggaggggg ctgctcagca agtccctgga gctgcaccgc cgcctggaga cgtccatgaa gtggtgtgat gaagggattt acctgctggc ctcacaacct gtggacaagt gccagtccca ggacggcgcg gaggctgccc tccaggaaat cgagaagttt ttggagaccg gtgcggaaaa taagatccag gagctcaacg cgatttacaa ggaatacgaa tccatcctca accaagatct catggagcac gtgcgaaagg tcttccagaa gcaggcaagc atggaggagg tgttccaccg caggcaggcc agcctgaaga agctggcggc caggcagacg cggcccgtgc agccggtggc ccccagaccc gaggcactgg caaagtcgcc ctgcccctcc ccaggcattc ggcgaggctc tgagaactcc agctccgagg gcggtgcgct ccggagaggg ccctaccgga gggccaagag tgagatgagt gagagccggc agggccgcgg ctcagcgggg gaggaggagg aaagcctggc catcctgcgc aggcacgtga tgagcgagct cctggacaca gaacgggcct acgtggagga gctgctgtgc gtcctggagg gctacgccgc ggagatggat aacccactga tggctcacct cctgtcaaca ggccttcaca acaagaagga tgttttgttt ggaaacatgg aggaaatcta tcacttccac aacaggatat tcctcaggga gctggaaaac tacactgact gcccagaact ggttggaaga tgctttctgg agaggatgga agatttccag atctatgaga agtactgtca gaacaagccc cgctctgaga gcctgtggag acagtgctcc gactgcccgt ttttccagga atgccagaga aagctggacc acaagctgag cctggactcc tacctgctga agccagtgca gaggatcacc aagtaccagc tgctgctcaa ggaaatgctg aaatacagca ggaactgcga gggggctgag gacctgcagg aggcgctgag ctccatcctg ggcatcctga aggccgtgaa cgactccatg cacctcatcg ctatcaccgg ctatgacggg aatctcggcg acctgggcaa gctgctgatg cagggctcgt tcagcgtctg gaccgaccac aagaggggcc acaccaaggt gaaggagctg gccaggttca agcccatgca gcggcacctg ttcctgcacg agaaggcagt gctcttctgc aagaagaggg aggagaatgg ggaggggtat gagaaagctc cctcctacag ctacaagcag tccttaaaca tggctgccgt tggcattacg gagaacgtga agggagatgc taagaagttc gagatctggt acaacgcgcg cgaggaggtc tacatcgtcc aggcgccaac tcctgagatt aaagccgcgt gggtgaatga aattcggaaa gtgctgacca gccagctgca ggcttgtaga gaagccagcc agcaccgggc gctggagcag tcacagagcc tgcccctgcc ggccccgacc agcaccagtc cctcaagagg aaactcaagg aacatcaaga agctggaaga aaggaaaaca gaccccctaa gcctggaggg atacgtcagc tcagcgccac tgacaaagcc ccccgaaaag ggcaaagagc cctag. It is sometimes possible for the material contained within the vial of "MCF2L, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.