Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MBNL3 cdna clone

MBNL3 cDNA Clone

Gene Names
MBNL3; CHCR; MBLX; MBXL; MBLX39
Synonyms
MBNL3; MBNL3 cDNA Clone; MBNL3 cdna clone
Ordering
For Research Use Only!
Sequence
atgttcgcccagcagatgcagcttatgctccaaaacgctcaaatgtcatcacttggttcttttcctatgactccatcaattccagctaatcctcccatggctttcaatccttacataccacatcctgggatgggcctcgttcctgcagaacttgtaccaaatacacctgttctgattcctggaaacccacctcttgcaatgccaggagctgttggcccaaaactgatgcgttcagataaactggaggtttgccgagaatttcagcgtggaaattgtacccgtggggagaatgattgccgctatgctcaccctactgatgcttccatgattgaagcgagtgataatactgtgacaatctgcatggattacatcaaaggtcgatgctcgcgggagaaatgcaagtactttcatcctcctgcacacttgcaagccagactcaaggcagctcatcatcagatgaaccattcagctgcctctgccatggccctgcagcctggtacactgcaactgataccaaagagatcagcactggaaaagcccaatggtgccaccccggtctttaatcccactgttttccactgccaacaggctctgactaacctgcagctcccacagccggcatttatccctgcagggccaatactgtgcatggcacccgcttcaaatattgtgcccatgatgcacggtgctacacctaccactgtgtctgcagcaacaacacctgccaccagcgttccgttcgctgcaccaactacaggcaatcagctgaaattctga
Sequence Length
777
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,687 Da
NCBI Official Full Name
Homo sapiens muscleblind-like 3 (Drosophila), mRNA
NCBI Official Synonym Full Names
muscleblind like splicing regulator 3
NCBI Official Symbol
MBNL3
NCBI Official Synonym Symbols
CHCR; MBLX; MBXL; MBLX39
NCBI Protein Information
muscleblind-like protein 3
UniProt Protein Name
Muscleblind-like protein 3
Protein Family
UniProt Gene Name
MBNL3
UniProt Synonym Gene Names
CHCR; MBLX39; MBXL
UniProt Entry Name
MBNL3_HUMAN

NCBI Description

This gene encodes a member of the muscleblind-like family of proteins. The encoded protein may function in regulation of alternative splicing and may play a role in the pathophysiology of myotonic dystrophy. Alternatively spliced transcript variants have been described. [provided by RefSeq, Dec 2009]

Uniprot Description

MBNL3: Mediates pre-mRNA alternative splicing regulation. Acts either as activator or repressor of splicing on specific pre-mRNA targets. Inhibits cardiac troponin-T (TNNT2) pre-mRNA exon inclusion but induces insulin receptor (IR) pre-mRNA exon inclusion in muscle. Antagonizes the alternative splicing activity pattern of CELF proteins. May play a role in myotonic dystrophy pathophysiology (DM). Could inhibit terminal muscle differentiation, acting at approximately the time of myogenin induction. Belongs to the muscleblind family. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: RNA-binding

Chromosomal Location of Human Ortholog: Xq26.2

Molecular Function: protein binding

Biological Process: regulation of RNA splicing

Research Articles on MBNL3

Similar Products

Product Notes

The MBNL3 mbnl3 (Catalog #AAA1269179) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttcgccc agcagatgca gcttatgctc caaaacgctc aaatgtcatc acttggttct tttcctatga ctccatcaat tccagctaat cctcccatgg ctttcaatcc ttacatacca catcctggga tgggcctcgt tcctgcagaa cttgtaccaa atacacctgt tctgattcct ggaaacccac ctcttgcaat gccaggagct gttggcccaa aactgatgcg ttcagataaa ctggaggttt gccgagaatt tcagcgtgga aattgtaccc gtggggagaa tgattgccgc tatgctcacc ctactgatgc ttccatgatt gaagcgagtg ataatactgt gacaatctgc atggattaca tcaaaggtcg atgctcgcgg gagaaatgca agtactttca tcctcctgca cacttgcaag ccagactcaa ggcagctcat catcagatga accattcagc tgcctctgcc atggccctgc agcctggtac actgcaactg ataccaaaga gatcagcact ggaaaagccc aatggtgcca ccccggtctt taatcccact gttttccact gccaacaggc tctgactaac ctgcagctcc cacagccggc atttatccct gcagggccaa tactgtgcat ggcacccgct tcaaatattg tgcccatgat gcacggtgct acacctacca ctgtgtctgc agcaacaaca cctgccacca gcgttccgtt cgctgcacca actacaggca atcagctgaa attctga. It is sometimes possible for the material contained within the vial of "MBNL3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.