MBIP cdna clone
MBIP cDNA Clone
Synonyms
MBIP; MBIP cDNA Clone; MBIP cdna clone
Sequence
atggctgctgccacggagcataatcgcccgagcagcggtgacaggaacctggagcgaagatgcagccccaacctctcccgagaggtgctctacgaaatctttcgctccctacacaccctggttggacagcttgacctcagagatgatgtggtgaaaattacaatcgattggaacaagctccagagcctctcggcattccagcctgcattgctctttagtgcacttgaacaacacattttatatttacagccttttttagcaaaacttcagtctccgattaaagaggagaatacaactgctgttgaagagataggaagaacagaaatggggaacaaaaatgaagtaaatgacaaattttccattggcgacctacaagaggaagaaaagcacaaagaaagtgatttaagagatgtgaaaaagacacagatccattttgatccagaagtagttcagataaaggctggaaaagcagaaattgacagacgaatatctgcatttattgaaagaaagcaagctgaaatcaatgaaaacaacgtcagggaattttgcaatgttatcgattgtaatcaagaaaatagttgtgcaagaactgatgcgatttttaccccttaccccggatttaaaagtcacgtaaaagtttctagagttgtgtatacatacggaccacagactagacctgaaggaattccagggtcaggtcataaacctaacagcatgcttcgagactgtggtaatcaggctgtagaagaacgactacaaaatattgaggcccacttgcggttacagacaggtggtccagtgccaagagacatttatcagagaattaaaaaacttgaggataaaatccttgaattggaaggcatctcccctgaatattttcagtctgtaagcttttctggaaaaagaagaaaagttcaaccacctcaacagaactattcactggctgaacttgatgagaaaattagtgccctcaaacaagccctcctcagaaaatcaagagaagcagaatccatggcaacccaccacctcccatga
Sequence Length
1035
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
39,153 Da
NCBI Official Full Name
Homo sapiens MAP3K12 binding inhibitory protein 1, mRNA
NCBI Official Synonym Full Names
MAP3K12 binding inhibitory protein 1
NCBI Official Symbol
MBIP
NCBI Protein Information
MAP3K12-binding inhibitory protein 1
UniProt Protein Name
MAP3K12-binding inhibitory protein 1
Protein Family
UniProt Gene Name
MBIP
UniProt Synonym Gene Names
MUK-binding inhibitory protein
UniProt Entry Name
MBIP1_HUMAN
Uniprot Description
MBIP: Inhibits the MAP3K12 activity to induce the activation of the JNK/SAPK pathway. Component of the ATAC complex, a complex with histone acetyltransferase activity on histones H3 and H4. 4 isoforms of the human protein are produced by alternative splicing.
Protein type: Protein kinase, regulatory subunit
Chromosomal Location of Human Ortholog: 14q13.3
Cellular Component: cytoplasm; nucleolus; nucleus
Molecular Function: identical protein binding; protein binding; protein kinase inhibitor activity
Biological Process: inactivation of MAPK activity during osmolarity sensing
Similar Products
Product Notes
The MBIP mbip (Catalog #AAA1272550) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgctg ccacggagca taatcgcccg agcagcggtg acaggaacct ggagcgaaga tgcagcccca acctctcccg agaggtgctc tacgaaatct ttcgctccct acacaccctg gttggacagc ttgacctcag agatgatgtg gtgaaaatta caatcgattg gaacaagctc cagagcctct cggcattcca gcctgcattg ctctttagtg cacttgaaca acacatttta tatttacagc cttttttagc aaaacttcag tctccgatta aagaggagaa tacaactgct gttgaagaga taggaagaac agaaatgggg aacaaaaatg aagtaaatga caaattttcc attggcgacc tacaagagga agaaaagcac aaagaaagtg atttaagaga tgtgaaaaag acacagatcc attttgatcc agaagtagtt cagataaagg ctggaaaagc agaaattgac agacgaatat ctgcatttat tgaaagaaag caagctgaaa tcaatgaaaa caacgtcagg gaattttgca atgttatcga ttgtaatcaa gaaaatagtt gtgcaagaac tgatgcgatt tttacccctt accccggatt taaaagtcac gtaaaagttt ctagagttgt gtatacatac ggaccacaga ctagacctga aggaattcca gggtcaggtc ataaacctaa cagcatgctt cgagactgtg gtaatcaggc tgtagaagaa cgactacaaa atattgaggc ccacttgcgg ttacagacag gtggtccagt gccaagagac atttatcaga gaattaaaaa acttgaggat aaaatccttg aattggaagg catctcccct gaatattttc agtctgtaag cttttctgga aaaagaagaa aagttcaacc acctcaacag aactattcac tggctgaact tgatgagaaa attagtgccc tcaaacaagc cctcctcaga aaatcaagag aagcagaatc catggcaacc caccacctcc catga. It is sometimes possible for the material contained within the vial of "MBIP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
