Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MAPK15 cdna clone

MAPK15 cDNA Clone

Gene Names
MAPK15; ERK7; ERK8
Synonyms
MAPK15; MAPK15 cDNA Clone; MAPK15 cdna clone
Ordering
For Research Use Only!
Sequence
atgtgcaccgtagtggaccctcgcattgtccggagatacctactcaggcggcagctcgggcagggggcctatggcattgtgtggaaggcagtggaccggaggactggtgaggtcgtggccatcaagaaaatctttgatgcttttagggataagacagatgcccagagaacattccgggaaatcacgctcctccaggagtttggggaccatcccaacatcatcagcctccttgacgtgatccgggcagagaacgacagggacatttacctggtgtttgagtttatgggttgcccccccagccccccacccccgactgcagtgcgcaccctctctgcagacactgacctgaacgcagtcatccggaagggcggcctgctgcaggacgtccacgtgcgctccatcttctaccagctcctgcgggccacccggttcctccactcggggcacgttgtgcaccgggaccagaagccgtccaatgtgctcctggatgccaactgcacagtgaagctgtgtgactttggcctggcccgctccctgggcgacctccctgaggggcctgaggaccaggccgtgacagagtacgtggccacacgctggtaccgagcaccggaggtgctgctctcttcgcaccgatacacccttggggtggacatgtggagtctgggctgtatcctgggggagatgctgcgggggagacccctgttccccggcacgtccaccctccaccagctggagctgatcctggagaccatcccaccgccatctgaggaggacctcctggctctcggctcaggctgccgtgcctctgtgctgcaccagctggggtcccggtga
Sequence Length
834
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
31,112 Da
NCBI Official Full Name
Homo sapiens mitogen-activated protein kinase 15, mRNA
NCBI Official Synonym Full Names
mitogen-activated protein kinase 15
NCBI Official Symbol
MAPK15
NCBI Official Synonym Symbols
ERK7; ERK8
NCBI Protein Information
mitogen-activated protein kinase 15
UniProt Protein Name
Mitogen-activated protein kinase 15
UniProt Gene Name
MAPK15
UniProt Synonym Gene Names
ERK7; ERK8; MAP kinase 15; MAPK 15; ERK-7; ERK-8
UniProt Entry Name
MK15_HUMAN

Uniprot Description

ERK7: In vitro, phosphorylates MBP. Belongs to the protein kinase superfamily. CMGC Ser/Thr protein kinase family. MAP kinase subfamily. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Kinase, protein; Protein kinase, CMGC; Protein kinase, Ser/Thr (non-receptor); EC 2.7.11.24; CMGC group; MAPK family; Erk7 subfamily

Chromosomal Location of Human Ortholog: -

Molecular Function: MAP kinase activity; protein binding

Biological Process: positive regulation of telomerase activity; positive regulation of telomere maintenance via telomerase; protein amino acid autophosphorylation

Research Articles on MAPK15

Similar Products

Product Notes

The MAPK15 mapk15 (Catalog #AAA1276035) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtgcaccg tagtggaccc tcgcattgtc cggagatacc tactcaggcg gcagctcggg cagggggcct atggcattgt gtggaaggca gtggaccgga ggactggtga ggtcgtggcc atcaagaaaa tctttgatgc ttttagggat aagacagatg cccagagaac attccgggaa atcacgctcc tccaggagtt tggggaccat cccaacatca tcagcctcct tgacgtgatc cgggcagaga acgacaggga catttacctg gtgtttgagt ttatgggttg cccccccagc cccccacccc cgactgcagt gcgcaccctc tctgcagaca ctgacctgaa cgcagtcatc cggaagggcg gcctgctgca ggacgtccac gtgcgctcca tcttctacca gctcctgcgg gccacccggt tcctccactc ggggcacgtt gtgcaccggg accagaagcc gtccaatgtg ctcctggatg ccaactgcac agtgaagctg tgtgactttg gcctggcccg ctccctgggc gacctccctg aggggcctga ggaccaggcc gtgacagagt acgtggccac acgctggtac cgagcaccgg aggtgctgct ctcttcgcac cgatacaccc ttggggtgga catgtggagt ctgggctgta tcctggggga gatgctgcgg gggagacccc tgttccccgg cacgtccacc ctccaccagc tggagctgat cctggagacc atcccaccgc catctgagga ggacctcctg gctctcggct caggctgccg tgcctctgtg ctgcaccagc tggggtcccg gtga. It is sometimes possible for the material contained within the vial of "MAPK15, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.