Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MAP4K2 cdna clone

MAP4K2 cDNA Clone

Gene Names
MAP4K2; GCK; BL44; RAB8IP
Synonyms
MAP4K2; MAP4K2 cDNA Clone; MAP4K2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgctgctgcgggatgtgtcgctgcaggacccgcgggaccgcttcgagctgctgcagcgcgtgggggccgggacctatggcgacgtctacaaggcccgcgacacggtcacgtccgaactggccgccgtgaagatagtcaagctagacccaggggacgacatcagctccctccagcaggaaatcaccatcctgcgtgagtgccgccaccccaatgtggtggcctacattggcagctacctcaggaatgaccgcttgtggatctgcatggagttctgcggagggggctccctgcaggagatttaccatgccactgggcccctggaggagcggcagattgcctacgtctgccgagaggcactgaaggggctccaccacctgcattctcaggggaagatccacagagacatcaagggagccaaccttctcctcactctccagggagatgtcaaactggctgactttggggtgtcaggcgagctgacagcgtctgtggccaagaggaggtctttcattgggactccctactggatggctcccgaggtggctgctgtggagcgcaaaggtggctacaatgagctatgtgacgtctgggccctgggcatcactgccattgagctgggcgagctgcagccccctctgttccacctgcaccccatgagggccctgatgctcatgtcgaagagcagcttccagccgcccaaactgagagataagactcgctggacccagaatttccaccactttctcaaactggccctgaccaagaatcctaagaagaggccgacagcagagaagctcctgcagcacccgttcacgactcagcagctccctcgggccctcctcacacagctgctggacaaagccagtgaccctcatctggggaccccctcccctgaggactgtgagctggagacctatgacatgtttccagacaccattcactcccgggggcagcacggcccagccgagaggaccccctcggagatccagtttcaccaggtgaaatttggcgccccacgcaggaaggaaactgacccactgaatgagccgtgggaggaagagtggacactactgggaaaggaagagttgagtgggagcctgctgcagtcggtccaggaggccctggaggaaaggagtctgactattcggtcagcctcagaattccaggagctggactccccagacgataccatgggaaccatcaagcgggccccgttcctagggccactccccactgaccctccagcagaggagcctctgtccagtcccccaggccccaacagctccccactgctgcccacggcctgggccaccatgaagcagcgggaggatcctgagaggtcatcctgccacgggctccccccaactcccaaggtgcatatgggcgcctgcttctccaaggtcttcaatggctgccccctgcggatccacgctgctgtcacctggattcaccctgttactcgggaccagttcctggtggtaggggccgaggaaggcatctacacactcaacctgcatgaactgcatgaggatacgctggagaagctgatttcacatcgctgctcctggctctactgcgtgaacaacgtgctgctgtcactctcagggaaatccacgcacatctgggcccatgacctcccaggcctgtttgagcagcggaggctacagcaacaggttcccctctccatccccaccaaccgcctcacccagcgcatcatccccaggcgctttgctctgtccaccaagattcctgacaccaaaggctgcttgcagtgtcgtgtggtgcggaatccctacacgggtgccaccttcctgctggccgccctgcccaccagcctgctcctgctgcagtggtatgagccgctgcagaagtttctgctgctgaagaacttctccagccctctgcccagcccagctgggatgctggagccgctggtgctggatgggaaggagctgccgcaggtgtgtgttggggccgaggggcctgaggggcccggctgccgcgtcctgttccatgtcctgcccctggaggctggcctgacgcccgacatcctcatcccacctgaggggatcccaggctcggcccagcaggtgatccaggtggacagggacacaatcctagtcagctttgaacgctgtgtgaggattgtcaacatgcagggcgagcccacggccacactggcacctgagctgacctttgatttccccatcgagactgtggtgtgcctgcaggacagtgtgctggccttctggagccatgggatgcaaggccgaagcctggataccaatgaggtgacccaggagatcacagatgaaacaaggatcttccgagtgcttggggcccacagagacatcatcctggagagcattcccactgacaacccagaggcgcacagcaacctctacatcctcacgggccaccagagcacctactaa
Sequence Length
2439
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
90,809 Da
NCBI Official Full Name
Homo sapiens mitogen-activated protein kinase kinase kinase kinase 2, mRNA
NCBI Official Synonym Full Names
mitogen-activated protein kinase kinase kinase kinase 2
NCBI Official Symbol
MAP4K2
NCBI Official Synonym Symbols
GCK; BL44; RAB8IP
NCBI Protein Information
mitogen-activated protein kinase kinase kinase kinase 2
UniProt Protein Name
Mitogen-activated protein kinase kinase kinase kinase 2
UniProt Gene Name
MAP4K2
UniProt Synonym Gene Names
GCK; RAB8IP; GC kinase; MEK kinase kinase 2; MEKKK 2
UniProt Entry Name
M4K2_HUMAN

NCBI Description

The protein encoded by this gene is a member of the serine/threonine protein kinase family. Although this kinase is found in many tissues, its expression in lymphoid follicles is restricted to the cells of germinal centre, where it may participate in B-cell differentiation. This kinase can be activated by TNF-alpha, and has been shown to specifically activate MAP kinases. This kinase is also found to interact with TNF receptor-associated factor 2 (TRAF2), which is involved in the activation of MAP3K1/MEKK1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]

Uniprot Description

GCK: Serine/threonine-protein kinase which acts as an essential component of the MAP kinase signal transduction pathway. Acts as a MAPK kinase kinase kinase (MAP4K) and is an upstream activator of the stress-activated protein kinase/c-Jun N-terminal kinase (SAP/JNK) signaling pathway and to a lesser extend of the p38 MAPKs signaling pathway. Required for the efficient activation of JNKs by TRAF6-dependent stimuli, including pathogen-associated molecular patterns (PAMPs) such as polyinosine-polycytidine (poly(IC)), lipopolysaccharides (LPS), lipid A, peptidoglycan (PGN), or bacterial flagellin. To a lesser degree, IL-1 and engagement of CD40 also stimulate MAP4K2-mediated JNKs activation. The requirement for MAP4K2/GCK is most pronounced for LPS signaling, and extends to LPS stimulation of c-Jun phosphorylation and induction of IL-8. Enhances MAP3K1 oligomerization, which may relieve N-terminal mediated MAP3K1 autoinhibition and lead to activation following autophosphorylation. Mediates also the SAP/JNK signaling pathway and the p38 MAPKs signaling pathway through activation of the MAP3Ks MAP3K10/MLK2 and MAP3K11/MLK3. May play a role in the regulation of vesicle targeting or fusion. regulation of vesicle targeting or fusion. Interacts with TRAF2, TRAF6, MAP3K1/MEKK1 and MAP3K11/MLK3. Interacts with RAB8A. Highly expressed in germinal center but not mantle zone B-cells. Also expressed in lung, brain and placenta and at lower levels in other tissues examined. The tumor necrosis factor (TNF), as well as endotoxins and proinflammatory stimuli such as polyinosine- polycytidine (poly(IC)), lipopolysaccharides (LPS), peptidoglycan (PGN), flagellin, or lipid A activate MAP4K2 by promoting its autophosphorylation. Belongs to the protein kinase superfamily. STE Ser/Thr protein kinase family. STE20 subfamily.

Protein type: EC 2.7.11.1; Protein kinase, STE; Protein kinase, Ser/Thr (non-receptor); Motility/polarity/chemotaxis; Kinase, protein; STE group; STE20 family; KHS subfamily

Chromosomal Location of Human Ortholog: 11q13

Molecular Function: ATP binding; mitogen-activated protein kinase kinase kinase binding; protein binding; protein serine/threonine kinase activity; receptor signaling protein serine/threonine kinase activity

Biological Process: activation of JNK activity; immune response; JNK cascade; positive regulation of JNK cascade; protein amino acid phosphorylation

Research Articles on MAP4K2

Similar Products

Product Notes

The MAP4K2 map4k2 (Catalog #AAA1276243) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgctgc tgcgggatgt gtcgctgcag gacccgcggg accgcttcga gctgctgcag cgcgtggggg ccgggaccta tggcgacgtc tacaaggccc gcgacacggt cacgtccgaa ctggccgccg tgaagatagt caagctagac ccaggggacg acatcagctc cctccagcag gaaatcacca tcctgcgtga gtgccgccac cccaatgtgg tggcctacat tggcagctac ctcaggaatg accgcttgtg gatctgcatg gagttctgcg gagggggctc cctgcaggag atttaccatg ccactgggcc cctggaggag cggcagattg cctacgtctg ccgagaggca ctgaaggggc tccaccacct gcattctcag gggaagatcc acagagacat caagggagcc aaccttctcc tcactctcca gggagatgtc aaactggctg actttggggt gtcaggcgag ctgacagcgt ctgtggccaa gaggaggtct ttcattggga ctccctactg gatggctccc gaggtggctg ctgtggagcg caaaggtggc tacaatgagc tatgtgacgt ctgggccctg ggcatcactg ccattgagct gggcgagctg cagccccctc tgttccacct gcaccccatg agggccctga tgctcatgtc gaagagcagc ttccagccgc ccaaactgag agataagact cgctggaccc agaatttcca ccactttctc aaactggccc tgaccaagaa tcctaagaag aggccgacag cagagaagct cctgcagcac ccgttcacga ctcagcagct ccctcgggcc ctcctcacac agctgctgga caaagccagt gaccctcatc tggggacccc ctcccctgag gactgtgagc tggagaccta tgacatgttt ccagacacca ttcactcccg ggggcagcac ggcccagccg agaggacccc ctcggagatc cagtttcacc aggtgaaatt tggcgcccca cgcaggaagg aaactgaccc actgaatgag ccgtgggagg aagagtggac actactggga aaggaagagt tgagtgggag cctgctgcag tcggtccagg aggccctgga ggaaaggagt ctgactattc ggtcagcctc agaattccag gagctggact ccccagacga taccatggga accatcaagc gggccccgtt cctagggcca ctccccactg accctccagc agaggagcct ctgtccagtc ccccaggccc caacagctcc ccactgctgc ccacggcctg ggccaccatg aagcagcggg aggatcctga gaggtcatcc tgccacgggc tccccccaac tcccaaggtg catatgggcg cctgcttctc caaggtcttc aatggctgcc ccctgcggat ccacgctgct gtcacctgga ttcaccctgt tactcgggac cagttcctgg tggtaggggc cgaggaaggc atctacacac tcaacctgca tgaactgcat gaggatacgc tggagaagct gatttcacat cgctgctcct ggctctactg cgtgaacaac gtgctgctgt cactctcagg gaaatccacg cacatctggg cccatgacct cccaggcctg tttgagcagc ggaggctaca gcaacaggtt cccctctcca tccccaccaa ccgcctcacc cagcgcatca tccccaggcg ctttgctctg tccaccaaga ttcctgacac caaaggctgc ttgcagtgtc gtgtggtgcg gaatccctac acgggtgcca ccttcctgct ggccgccctg cccaccagcc tgctcctgct gcagtggtat gagccgctgc agaagtttct gctgctgaag aacttctcca gccctctgcc cagcccagct gggatgctgg agccgctggt gctggatggg aaggagctgc cgcaggtgtg tgttggggcc gaggggcctg aggggcccgg ctgccgcgtc ctgttccatg tcctgcccct ggaggctggc ctgacgcccg acatcctcat cccacctgag gggatcccag gctcggccca gcaggtgatc caggtggaca gggacacaat cctagtcagc tttgaacgct gtgtgaggat tgtcaacatg cagggcgagc ccacggccac actggcacct gagctgacct ttgatttccc catcgagact gtggtgtgcc tgcaggacag tgtgctggcc ttctggagcc atgggatgca aggccgaagc ctggatacca atgaggtgac ccaggagatc acagatgaaa caaggatctt ccgagtgctt ggggcccaca gagacatcat cctggagagc attcccactg acaacccaga ggcgcacagc aacctctaca tcctcacggg ccaccagagc acctactaa. It is sometimes possible for the material contained within the vial of "MAP4K2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.