Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MAP2K2 cdna clone

MAP2K2 cDNA Clone

Gene Names
MAP2K2; CFC4; MEK2; MKK2; MAPKK2; PRKMK2
Synonyms
MAP2K2; MAP2K2 cDNA Clone; MAP2K2 cdna clone
Ordering
For Research Use Only!
Sequence
atgctggcccggaggaagccggtgctgccggcgctcaccatcaaccctaccatcgccgagggcccatcccctaccagcgagggcgcctccgaggcaaacctggtggacctgcagaagaagctggaggagctggaacttgacgagcagcagaagaagcggctggaagcctttctcacccagaaagccaaggtcggcgaactcaaagacgatgacttcgaaaggatctcagagctgggcgcgggcaacggcggggtggtcaccaaagtccagcacagaccctcgggcctcatcatggccaggaagctgatccaccttgagatcaagccggccatccggaaccagatcatccgcgagctgcaggtcctgcacgaatgcaactcgccgtacatcgtgggcttctacggggccttctacagtgacggggagatcagcatttgcatggaacacatggatggcggctccctggaccaggtgctgaaagaggccaagaggattcccgaggagatcctggggaaagtcagcatcgcggttctccggggcttggcgtacctccgagagaagcaccagatcatgcaccgagatgtgaagccctccaacatcctcgtgaactctagaggggagatcaagctgtgtgacttcggggtgagcggccagctcatagactccatggccaactccttcgtgggcacgcgctcctacatggctccggagcggttgcagggcacacattactcggtgcagtcggacatctggagcatgggcctgtccctggtggagctggccgtcggaaggtaccccatccccccgcccgacgccaaagagctggaggccatctttggccggcccgtggtcgacggggaagaaggagagcctcacagcatctcgcctcggccgaggccccccgggcgccccgtcagcggtcacgggatggatagccggcctgccatggccatctttgaactcctggactatattgtgaacgagccacctcctaagctgcccaacggtgtgttcacccccgacttccaggagtttgtcaataaatgcctcatcaagaacccagcggagcgggcggacctgaagatgctcacaaaccacaccttcatcaagcggtccgaggtggaagaagtggattttgccggctggttgtgtaaaaccctgcggctgaaccagcccggcacacccacgcgcaccgccgtgtga
Sequence Length
1203
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
44,424 Da
NCBI Official Full Name
Homo sapiens mitogen-activated protein kinase kinase 2, mRNA
NCBI Official Synonym Full Names
mitogen-activated protein kinase kinase 2
NCBI Official Symbol
MAP2K2
NCBI Official Synonym Symbols
CFC4; MEK2; MKK2; MAPKK2; PRKMK2
NCBI Protein Information
dual specificity mitogen-activated protein kinase kinase 2
UniProt Protein Name
Dual specificity mitogen-activated protein kinase kinase 2
UniProt Gene Name
MAP2K2
UniProt Synonym Gene Names
MEK2; MKK2; PRKMK2; MAP kinase kinase 2; MAPKK 2; MEK 2
UniProt Entry Name
MP2K2_HUMAN

NCBI Description

The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase is known to play a critical role in mitogen growth factor signal transduction. It phosphorylates and thus activates MAPK1/ERK2 and MAPK2/ERK3. The activation of this kinase itself is dependent on the Ser/Thr phosphorylation by MAP kinase kinase kinases. Mutations in this gene cause cardiofaciocutaneous syndrome (CFC syndrome), a disease characterized by heart defects, mental retardation, and distinctive facial features similar to those found in Noonan syndrome. The inhibition or degradation of this kinase is also found to be involved in the pathogenesis of Yersinia and anthrax. A pseudogene, which is located on chromosome 7, has been identified for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

MEK2: a dual-specificity protein kinase of the STE7 kinase family. Phosphorylated and activated by Raf and Mos kinases. Phosphorylates a Thr and a Tyr residue in a Thr-Glu-Tyr sequence located in the activation loop of ERK2 and ERK3. A component of MAP kinase signal transduction pathways involved in mitogen growth factor signal transduction.

Protein type: EC 2.7.12.2; Protein kinase, dual-specificity (non-receptor); Protein kinase, STE; Kinase, protein; STE group; STE7 family

Chromosomal Location of Human Ortholog: 19p13.3

Cellular Component: cytoplasm; cytosol; early endosome; endoplasmic reticulum; focal adhesion; Golgi apparatus; intercellular junction; internal side of plasma membrane; late endosome; microtubule; mitochondrion; nucleus; perinuclear region of cytoplasm; peroxisomal membrane

Molecular Function: MAP kinase kinase activity; PDZ domain binding; protein binding; protein serine/threonine kinase activator activity; protein serine/threonine kinase activity; protein serine/threonine/tyrosine kinase activity; receptor signaling protein serine/threonine kinase activity

Biological Process: activation of MAPK activity; MAPKKK cascade; positive regulation of transcription, DNA-dependent; regulation of stress-activated MAPK cascade

Disease: Cardiofaciocutaneous Syndrome 4

Research Articles on MAP2K2

Similar Products

Product Notes

The MAP2K2 map2k2 (Catalog #AAA1266261) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctggccc ggaggaagcc ggtgctgccg gcgctcacca tcaaccctac catcgccgag ggcccatccc ctaccagcga gggcgcctcc gaggcaaacc tggtggacct gcagaagaag ctggaggagc tggaacttga cgagcagcag aagaagcggc tggaagcctt tctcacccag aaagccaagg tcggcgaact caaagacgat gacttcgaaa ggatctcaga gctgggcgcg ggcaacggcg gggtggtcac caaagtccag cacagaccct cgggcctcat catggccagg aagctgatcc accttgagat caagccggcc atccggaacc agatcatccg cgagctgcag gtcctgcacg aatgcaactc gccgtacatc gtgggcttct acggggcctt ctacagtgac ggggagatca gcatttgcat ggaacacatg gatggcggct ccctggacca ggtgctgaaa gaggccaaga ggattcccga ggagatcctg gggaaagtca gcatcgcggt tctccggggc ttggcgtacc tccgagagaa gcaccagatc atgcaccgag atgtgaagcc ctccaacatc ctcgtgaact ctagagggga gatcaagctg tgtgacttcg gggtgagcgg ccagctcata gactccatgg ccaactcctt cgtgggcacg cgctcctaca tggctccgga gcggttgcag ggcacacatt actcggtgca gtcggacatc tggagcatgg gcctgtccct ggtggagctg gccgtcggaa ggtaccccat ccccccgccc gacgccaaag agctggaggc catctttggc cggcccgtgg tcgacgggga agaaggagag cctcacagca tctcgcctcg gccgaggccc cccgggcgcc ccgtcagcgg tcacgggatg gatagccggc ctgccatggc catctttgaa ctcctggact atattgtgaa cgagccacct cctaagctgc ccaacggtgt gttcaccccc gacttccagg agtttgtcaa taaatgcctc atcaagaacc cagcggagcg ggcggacctg aagatgctca caaaccacac cttcatcaag cggtccgagg tggaagaagt ggattttgcc ggctggttgt gtaaaaccct gcggctgaac cagcccggca cacccacgcg caccgccgtg tga. It is sometimes possible for the material contained within the vial of "MAP2K2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.