Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MAOB cdna clone

MAOB cDNA Clone

Synonyms
MAOB; MAOB cDNA Clone; MAOB cdna clone
Ordering
For Research Use Only!
Sequence
atgagcaacaaatgcgacgtggtcgtggtggggggcggcatctcaggtatggcagcagccaaacttctgcatgactctggactgaatgtggttgttctggaagcccgggaccatgtgggaggcaggacttacactcttaggaaccaaaaggttaaatatgtggaccttggaggatcctatgttggaccaacccagaatcgtatcttgagattagccaaggagctaggattggagacctacaaagtgaatgaggttgagcgtctgatccaccatgtaaagggcaaatcataccccttcagggggccattcccacctgtatggaatccaattacctacttagatcataacaacttttggaggacaatggatgacatggggcgagagattcagagtgatgccccatggaaggctccccttgcagaagagtgggacaacatgacaatgaaggagctactggacaagctctgctggactgaatctgcaaagcagcttgccactctctttgtgaacctgtgtgtcactgcagagacccatgaggtctctgctctctggttcctgtggtatgtgaagcagtgtggaggcacaacaagaatcatctcgacaacaaatggaggacaggagaggaaatttgtgggcggatctggtcaagtgagtgagcggataatggacctccttggagaccgagtgaagctggagaggcctgtgatctacattgaccagacaagagaaaatgtccttgtggagaccctaaaccatgagatgtatgaggctaaatatgtgattagtgctattcctcctactctgggcatgaagattcacttcaatccccctctgccaatgatgagaaaccagatgatcactcgtgtgcctttgggttcagtcatcaagtgtatagtttattataaagagcctttctggaggaaaaaggattactgtggaaccatgattattgatggagaagaagctccagttgcctacacgttggatgataccaaacctgaaggcaactatgctgccataatgggatttatcctggcccacaaagccagaaaactggcacgtcttaccaaagaggaaaggttgaagaaactttgtgaactctatgccaaggttctgggttccctagaagctctggagccagtgcattatgaagaaaagaactggtgtgaggagcagtactctgggggctgctacacaacttatttcccccctgggatcctgactcaatatggaagggttctacgccagccagtggacaggatttactttgcaggcaccgagactgccacacactggagcggctacatggagggggctgtagaggccggggagagagcagcccgagagatcctgcatgccatggggaagattccagaggatgaaatctggcagtcagaaccagagtctgtggatgtccctgcacagcccatcaccaccacctttttggagagacatttgccctccgtgccaggcctgctcaggctgattggattgaccaccatcttttcagcaacggctcttggcttcctggcccacaaaagggggctacttgtgagagtctaa
Sequence Length
1563
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
46,539 Da
NCBI Official Full Name
Homo sapiens monoamine oxidase B, mRNA
NCBI Official Synonym Full Names
monoamine oxidase B
NCBI Official Symbol
MAOB
NCBI Protein Information
amine oxidase [flavin-containing] B
UniProt Protein Name
Amine oxidase [flavin-containing] B
Protein Family
UniProt Gene Name
MAOB
UniProt Synonym Gene Names
MAO-B
UniProt Entry Name
AOFB_HUMAN

NCBI Description

The protein encoded by this gene belongs to the flavin monoamine oxidase family. It is a enzyme located in the mitochondrial outer membrane. It catalyzes the oxidative deamination of biogenic and xenobiotic amines and plays an important role in the metabolism of neuroactive and vasoactive amines in the central nervous sysytem and peripheral tissues. This protein preferentially degrades benzylamine and phenylethylamine. [provided by RefSeq, Jul 2008]

Uniprot Description

MAOB: Catalyzes the oxidative deamination of biogenic and xenobiotic amines and has important functions in the metabolism of neuroactive and vasoactive amines in the central nervous system and peripheral tissues. MAOB preferentially degrades benzylamine and phenylethylamine. Belongs to the flavin monoamine oxidase family.

Protein type: Amino Acid Metabolism - glycine, serine and threonine; Oxidoreductase; Xenobiotic Metabolism - drug metabolism - cytochrome P450; Amino Acid Metabolism - histidine; Amino Acid Metabolism - phenylalanine; Membrane protein, integral; Amino Acid Metabolism - tryptophan; EC 1.4.3.4; Amino Acid Metabolism - arginine and proline; Mitochondrial; Amino Acid Metabolism - tyrosine

Chromosomal Location of Human Ortholog: Xp11.23

Cellular Component: mitochondrial envelope; mitochondrial outer membrane; mitochondrion

Molecular Function: amine oxidase activity; electron carrier activity

Biological Process: dopamine catabolic process; substantia nigra development

Research Articles on MAOB

Similar Products

Product Notes

The MAOB maob (Catalog #AAA1268571) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcaaca aatgcgacgt ggtcgtggtg gggggcggca tctcaggtat ggcagcagcc aaacttctgc atgactctgg actgaatgtg gttgttctgg aagcccggga ccatgtggga ggcaggactt acactcttag gaaccaaaag gttaaatatg tggaccttgg aggatcctat gttggaccaa cccagaatcg tatcttgaga ttagccaagg agctaggatt ggagacctac aaagtgaatg aggttgagcg tctgatccac catgtaaagg gcaaatcata ccccttcagg gggccattcc cacctgtatg gaatccaatt acctacttag atcataacaa cttttggagg acaatggatg acatggggcg agagattcag agtgatgccc catggaaggc tccccttgca gaagagtggg acaacatgac aatgaaggag ctactggaca agctctgctg gactgaatct gcaaagcagc ttgccactct ctttgtgaac ctgtgtgtca ctgcagagac ccatgaggtc tctgctctct ggttcctgtg gtatgtgaag cagtgtggag gcacaacaag aatcatctcg acaacaaatg gaggacagga gaggaaattt gtgggcggat ctggtcaagt gagtgagcgg ataatggacc tccttggaga ccgagtgaag ctggagaggc ctgtgatcta cattgaccag acaagagaaa atgtccttgt ggagacccta aaccatgaga tgtatgaggc taaatatgtg attagtgcta ttcctcctac tctgggcatg aagattcact tcaatccccc tctgccaatg atgagaaacc agatgatcac tcgtgtgcct ttgggttcag tcatcaagtg tatagtttat tataaagagc ctttctggag gaaaaaggat tactgtggaa ccatgattat tgatggagaa gaagctccag ttgcctacac gttggatgat accaaacctg aaggcaacta tgctgccata atgggattta tcctggccca caaagccaga aaactggcac gtcttaccaa agaggaaagg ttgaagaaac tttgtgaact ctatgccaag gttctgggtt ccctagaagc tctggagcca gtgcattatg aagaaaagaa ctggtgtgag gagcagtact ctgggggctg ctacacaact tatttccccc ctgggatcct gactcaatat ggaagggttc tacgccagcc agtggacagg atttactttg caggcaccga gactgccaca cactggagcg gctacatgga gggggctgta gaggccgggg agagagcagc ccgagagatc ctgcatgcca tggggaagat tccagaggat gaaatctggc agtcagaacc agagtctgtg gatgtccctg cacagcccat caccaccacc tttttggaga gacatttgcc ctccgtgcca ggcctgctca ggctgattgg attgaccacc atcttttcag caacggctct tggcttcctg gcccacaaaa gggggctact tgtgagagtc taa. It is sometimes possible for the material contained within the vial of "MAOB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.