Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MAGEA5 cdna clone

MAGEA5 cDNA Clone

Gene Names
MAGEA5; CT1.5; MAGE5; MAGEA4
Synonyms
MAGEA5; MAGEA5 cDNA Clone; MAGEA5 cdna clone
Ordering
For Research Use Only!
Sequence
ATGTCTCTTGAGCAGAAGAGTCAGCACTGCAAGCCTGAGGAAGGCCTTGACACCCAAGAAGAGGCCCTGGGCCTGGTGGGTGTGCAGGCTGCCACTACTGAGGAGCAGGAGGCTGTGTCCTCCTCCTCTCCTCTGGTCCCAGGCACCCTGGGGGAGGTGCCTGCTGCTGGGTCACCAGGTCCTCTCAAGAGTCCTCAGGGAGCCTCCGCCATCCCCACTGCCATCGATTTCACTCTATGGAGGCAATCCATTAAGGGCTCCAGCAACCAAGAAGAGGAGGGGCCAAGCACCTCCCCTGACCCAGAGTCTGTGTTCCGAGCAGCACTCAGTAAGAAGGTGGCTGACTTGATTCATTTTCTGCTCCTCAAGTATTAA
Sequence Length
375
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
13,016 Da
NCBI Official Full Name
Homo sapiens melanoma antigen family A, 5, mRNA
NCBI Official Synonym Full Names
MAGE family member A5
NCBI Official Symbol
MAGEA5
NCBI Official Synonym Symbols
CT1.5; MAGE5; MAGEA4
NCBI Protein Information
melanoma-associated antigen 5
UniProt Protein Name
Melanoma-associated antigen 5
UniProt Gene Name
MAGEA5
UniProt Synonym Gene Names
MAGE5; CT1.5
UniProt Entry Name
MAGA5_HUMAN

NCBI Description

This gene is a member of the MAGEA gene family. The members of this family encode proteins with 50 to 80% sequence identity to each other. The promoters and first exons of the MAGEA genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. The MAGEA genes are clustered at chromosomal location Xq28. They have been implicated in some hereditary disorders, such as dyskeratosis congenita. This MAGEA gene encodes a protein that is C-terminally truncated compared to other family members, and this gene can be alternatively interpreted to be a pseudogene. The protein is represented in this Gene record in accordance with the assumed protein-coding status defined in the literature. Read-through transcription exists between this gene and the upstream melanoma antigen family A, 10 (MAGEA10) gene. [provided by RefSeq, Oct 2011]

Uniprot Description

MAGE-A5: Not known, though may play a role tumor transformation or progression. In vitro promotes cell viability in melanoma cell lines.

Protein type: Cancer Testis Antigen (CTA)

Chromosomal Location of Human Ortholog: Xq28

Research Articles on MAGEA5

Similar Products

Product Notes

The MAGEA5 magea5 (Catalog #AAA1274068) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGTCTCTTG AGCAGAAGAG TCAGCACTGC AAGCCTGAGG AAGGCCTTGA CACCCAAGAA GAGGCCCTGG GCCTGGTGGG TGTGCAGGCT GCCACTACTG AGGAGCAGGA GGCTGTGTCC TCCTCCTCTC CTCTGGTCCC AGGCACCCTG GGGGAGGTGC CTGCTGCTGG GTCACCAGGT CCTCTCAAGA GTCCTCAGGG AGCCTCCGCC ATCCCCACTG CCATCGATTT CACTCTATGG AGGCAATCCA TTAAGGGCTC CAGCAACCAA GAAGAGGAGG GGCCAAGCAC CTCCCCTGAC CCAGAGTCTG TGTTCCGAGC AGCACTCAGT AAGAAGGTGG CTGACTTGAT TCATTTTCTG CTCCTCAAGT ATTAA. It is sometimes possible for the material contained within the vial of "MAGEA5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.