Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MAD2L1 cdna clone

MAD2L1 cDNA Clone

Gene Names
MAD2L1; MAD2; HSMAD2
Synonyms
MAD2L1; MAD2L1 cDNA Clone; MAD2L1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgctgcagctctcccgggagcagggaatcaccctgcgcgggagcgccgaaatcgtggccgagttcttctcattcggcatcaacagcattttatatcagcgtggcatatatccatctgaaacctttactcgagtgcagaaatacggactcaccttgcttgtaactactgatcttgagctcataaaatacctaaataatgtggtggaacaactgaaagattggttatacaagtgttcagttcagaaactggttgtagttatctcaaatattgaaagtggtgaggtcctggaaagatggcagtttgatattgagtgtgacaagactgcaaaagatgacagtgcacccagagaaaagtctcagaaagctatccaggatgaaatccgttcagtgatcagacagatcacagctacggtgacatttctgccactgttggaagtttcttgttcatttgatctgctgatttatacagacaaagatttggttgtacctgaaaaatgggaagagtcgggaccacagtttattaccaattctgaggaagtccgccttcgttcatttactactacaatccacaaagtaaatagcatggtggcctacaaaattcctgtcaatgactga
Sequence Length
618
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
10,335 Da
NCBI Official Full Name
Homo sapiens MAD2 mitotic arrest deficient-like 1 (yeast), mRNA
NCBI Official Synonym Full Names
MAD2 mitotic arrest deficient-like 1 (yeast)
NCBI Official Symbol
MAD2L1
NCBI Official Synonym Symbols
MAD2; HSMAD2
NCBI Protein Information
mitotic spindle assembly checkpoint protein MAD2A
UniProt Protein Name
Mitotic spindle assembly checkpoint protein MAD2A
Protein Family
UniProt Gene Name
MAD2L1
UniProt Synonym Gene Names
MAD2; HsMAD2; MAD2-like protein 1
UniProt Entry Name
MD2L1_HUMAN

NCBI Description

MAD2L1 is a component of the mitotic spindle assembly checkpoint that prevents the onset of anaphase until all chromosomes are properly aligned at the metaphase plate. MAD2L1 is related to the MAD2L2 gene located on chromosome 1. A MAD2 pseudogene has been mapped to chromosome 14. [provided by RefSeq, Jul 2008]

Uniprot Description

MAD2L1: required for the mitotic checkpoint which monitors the process of kinetochore-spindle attachment and delays the onset of anaphase when this process is not complete. Inhibits the activity of the anaphase promoting complex by sequestering CDC20 until all chromosomes are aligned at the metaphase plate. Interacts with Cdc20, MAD2L1BP and with ADAM17/TACE

Protein type: Cell cycle regulation

Chromosomal Location of Human Ortholog: 4q27

Cellular Component: cytosol; kinetochore; nuclear pore; nucleus; perinuclear region of cytoplasm

Molecular Function: identical protein binding; protein binding; protein homodimerization activity

Biological Process: anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process; mitotic cell cycle checkpoint; negative regulation of apoptosis; negative regulation of mitotic cell cycle; negative regulation of protein catabolic process; negative regulation of ubiquitin-protein ligase activity during mitotic cell cycle; positive regulation of ubiquitin-protein ligase activity during mitotic cell cycle; proteasomal ubiquitin-dependent protein catabolic process; protein ubiquitination during ubiquitin-dependent protein catabolic process; sister chromatid cohesion

Research Articles on MAD2L1

Similar Products

Product Notes

The MAD2L1 mad2l1 (Catalog #AAA1276282) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgctgc agctctcccg ggagcaggga atcaccctgc gcgggagcgc cgaaatcgtg gccgagttct tctcattcgg catcaacagc attttatatc agcgtggcat atatccatct gaaaccttta ctcgagtgca gaaatacgga ctcaccttgc ttgtaactac tgatcttgag ctcataaaat acctaaataa tgtggtggaa caactgaaag attggttata caagtgttca gttcagaaac tggttgtagt tatctcaaat attgaaagtg gtgaggtcct ggaaagatgg cagtttgata ttgagtgtga caagactgca aaagatgaca gtgcacccag agaaaagtct cagaaagcta tccaggatga aatccgttca gtgatcagac agatcacagc tacggtgaca tttctgccac tgttggaagt ttcttgttca tttgatctgc tgatttatac agacaaagat ttggttgtac ctgaaaaatg ggaagagtcg ggaccacagt ttattaccaa ttctgaggaa gtccgccttc gttcatttac tactacaatc cacaaagtaa atagcatggt ggcctacaaa attcctgtca atgactga. It is sometimes possible for the material contained within the vial of "MAD2L1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.