LYPD6B cdna clone
LYPD6B cDNA Clone
Gene Names
LYPD6B; CT116; LYPD7
Synonyms
LYPD6B; LYPD6B cDNA Clone; LYPD6B cdna clone
Sequence
atgctgctcctctgtcacgctctcgctatagctgttgtccagatcgttatcttctcagaaagctgggcatttgccaagaacatcaacttctataatgtgaggcctcctctcgaccctacaccatttccaaatagcttcaagtgctttacttgtgaaaacgcaggggataattataactgcaatcgatgggcagaagacaaatggtgtccacaaaatacacagtactgtttgacagttcatcacttcaccagccacggaagaagcacatccatcaccaaaaagtgtgcctccagaagtgaatgtcattttgtcggttgccaccacagccgagattctgaacatacggagtgtaggtcttgctgtgaaggaatgatctgcaatgtagaattacccaccaatcacactatgcagtgtttgccgtaa
Sequence Length
423
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
23,340 Da
NCBI Official Full Name
Homo sapiens LY6/PLAUR domain containing 6B, mRNA
NCBI Official Synonym Full Names
LY6/PLAUR domain containing 6B
NCBI Official Symbol
LYPD6B
NCBI Official Synonym Symbols
CT116; LYPD7
NCBI Protein Information
ly6/PLAUR domain-containing protein 6B
UniProt Protein Name
Ly6/PLAUR domain-containing protein 6B
Protein Family
UniProt Gene Name
LYPD6B
UniProt Entry Name
LPD6B_HUMAN
Uniprot Description
LYPD6B: 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Cancer Testis Antigen (CTA); Membrane protein, GPI anchor
Chromosomal Location of Human Ortholog: 2q23.2
Research Articles on LYPD6B
Similar Products
Product Notes
The LYPD6B lypd6b (Catalog #AAA1269460) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgctcc tctgtcacgc tctcgctata gctgttgtcc agatcgttat cttctcagaa agctgggcat ttgccaagaa catcaacttc tataatgtga ggcctcctct cgaccctaca ccatttccaa atagcttcaa gtgctttact tgtgaaaacg caggggataa ttataactgc aatcgatggg cagaagacaa atggtgtcca caaaatacac agtactgttt gacagttcat cacttcacca gccacggaag aagcacatcc atcaccaaaa agtgtgcctc cagaagtgaa tgtcattttg tcggttgcca ccacagccga gattctgaac atacggagtg taggtcttgc tgtgaaggaa tgatctgcaa tgtagaatta cccaccaatc acactatgca gtgtttgccg taa. It is sometimes possible for the material contained within the vial of "LYPD6B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
