Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LYG2 cdna clone

LYG2 cDNA Clone

Gene Names
LYG2; LYGH; LYSG2
Synonyms
LYG2; LYG2 cDNA Clone; LYG2 cdna clone
Ordering
For Research Use Only!
Sequence
ATGTTATCCTCCGTGGTGTTTTGGGGACTAATTGCCCTCATTGGCACTTCCAGGGGCTCATACCCCTTCAGTCACTCAATGAAGCCTCACCTACATCCACGCCTGTACCACGGCTGCTATGGGGACATCATGACCATGAAGACCTCTGGGGCCACTTGTGATGCAAACAGTGTGATGAACTGCGGGATCCGTGGTTCTGAAATGTTTGCTGAGATGGATTTGAGGGCCATAAAACCTTACCAGACTCTGATCAAAGAAGTCGGGCAGAGACATTGCGTGGACCCTGCTGTCATCGCAGCCATCATCTCCAGGGAAAGCCATGGCGGATCTGTCCTGCAAGACGGCTGGGACCACAGGGGACTTAAATTTGGCTTGATGCAGCTTGATAAACAAACGTACCACCCTGTCGGTGCCTGGGATAGCAAAGAGCACCTTTCACAGGCTACTGGGATTCTAACAGAGAGAATTAAGGCAATCCAGAAAAAATTCCCCACGTGGAGTGTTGCTCAGCACCTCAAAGGTGGTCTCTCAGCTTTTAAGTCAGGAATTGAAGCGATTGCCACCCCATCGGACATAGACAATGACTTCGTCAATGATATCATTGCTCGAGCTAAGTTCTATAAAAGACAAAGCTTCTAG
Sequence Length
639
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
19,830 Da
NCBI Official Full Name
Homo sapiens lysozyme G-like 2, mRNA
NCBI Official Synonym Full Names
lysozyme g2
NCBI Official Symbol
LYG2
NCBI Official Synonym Symbols
LYGH; LYSG2
NCBI Protein Information
lysozyme g-like protein 2
UniProt Protein Name
Lysozyme g-like protein 2
Protein Family
UniProt Gene Name
LYG2
UniProt Synonym Gene Names
LYGH
UniProt Entry Name
LYG2_HUMAN

NCBI Description

The protein encoded by this gene contains a SLT domain, a protein domain present in bacterial lytic transglycosylase (SLT) and in eukaryotic lysozymes (GEWL). SLT domain catalyzes the cleavage of the beta-1,4-glycosidic bond between N-acetylmuramic acid (MurNAc) and N-acetyglucosamine (GlcNAc). [provided by RefSeq, Jul 2008]

Uniprot Description

LYG2: contains a SLT domain, a protein domain present in bacterial lytic transglycosylase (SLT) and in eukaryotic lysozymes (GEWL). SLT domain catalyzes the cleavage of the beta-1,4-glycosidic bond between N-acetylmuramic acid (MurNAc) and N-acetyglucosamine (GlcNAc). [provided by RefSeq, Jul 2008]

Protein type: Secreted, signal peptide; Secreted; Hydrolase; EC 3.2.1.-

Chromosomal Location of Human Ortholog: 2q11.2

Research Articles on LYG2

Similar Products

Product Notes

The LYG2 lyg2 (Catalog #AAA1267938) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGTTATCCT CCGTGGTGTT TTGGGGACTA ATTGCCCTCA TTGGCACTTC CAGGGGCTCA TACCCCTTCA GTCACTCAAT GAAGCCTCAC CTACATCCAC GCCTGTACCA CGGCTGCTAT GGGGACATCA TGACCATGAA GACCTCTGGG GCCACTTGTG ATGCAAACAG TGTGATGAAC TGCGGGATCC GTGGTTCTGA AATGTTTGCT GAGATGGATT TGAGGGCCAT AAAACCTTAC CAGACTCTGA TCAAAGAAGT CGGGCAGAGA CATTGCGTGG ACCCTGCTGT CATCGCAGCC ATCATCTCCA GGGAAAGCCA TGGCGGATCT GTCCTGCAAG ACGGCTGGGA CCACAGGGGA CTTAAATTTG GCTTGATGCA GCTTGATAAA CAAACGTACC ACCCTGTCGG TGCCTGGGAT AGCAAAGAGC ACCTTTCACA GGCTACTGGG ATTCTAACAG AGAGAATTAA GGCAATCCAG AAAAAATTCC CCACGTGGAG TGTTGCTCAG CACCTCAAAG GTGGTCTCTC AGCTTTTAAG TCAGGAATTG AAGCGATTGC CACCCCATCG GACATAGACA ATGACTTCGT CAATGATATC ATTGCTCGAG CTAAGTTCTA TAAAAGACAA AGCTTCTAG. It is sometimes possible for the material contained within the vial of "LYG2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.