LUC7L cdna clone
LUC7L cDNA Clone
Gene Names
LUC7L; Luc7; SR+89; LUC7B1; hLuc7B1
Synonyms
LUC7L; LUC7L cDNA Clone; LUC7L cdna clone
Sequence
atgcagatgggagacgaaaccagacagagggtcaagtttacagatgaccgtgtctgcaagagtcaccttctggactgctgcccccatgacatcctggctgggacgcgcatggatttaggagaatgtaccaaaatccacgacttggccctccgagcagattatgagattgcaagtaaagaaagagacctgttttttgaattagatgcaatggatcacttggagtcctttattgctgaatgtgatcggagaactgagctcgccaagaagcggctggcagaaacacaggaggaaatcagtgcggaagtttctgcaaaggcagaaaaagtacatgagttaaatgaagaaataggaaaactccttgctaaagccgaacagctaggggctgaaggtaatgtggatgaatcccagaagattcttatggaagtggaaaaagttcgtgcgaagaaaaaagaagctgaggaagaatacagaaattccatgcctgcatccagttttcagcagcaaaagctgcgtgtctgcgaggtctgttcagcctaccttggtctccatgacaatgaccgtcgcctggcagaccacttcggtggcaagttacacttggggttcattcagatccgagagaagcttgatcagttgaggaaaactgtcgctgaaaagcaggagaagagaaatcaggatcgcttgaggaggagagaggagagggaacgggaggagcgtctgagcaggaggtcgggatcaagaaccagagatcgcaggaggtcacgctcccgggatcggcgtcggaggcggtcaagatctacctcccgagagcgacggaaattgtcccggtcccggtcccgagatagacatcggcgccaccgcagccgttcccggagccacagccggggacatcgtcgggcttcccgggaccgaagtgcgaaatacaagttctccagagagcgggcatccagagaggagtcctgggagagcgggcggagcgagcgagggcccccggactggaggcttgagagctccaacgggaagatggcttcacggaggtcagaagagaaggaggccggcgagatctga
Sequence Length
1065
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
41,929 Da
NCBI Official Full Name
Homo sapiens LUC7-like (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
LUC7 like
NCBI Official Symbol
LUC7L
NCBI Official Synonym Symbols
Luc7; SR+89; LUC7B1; hLuc7B1
NCBI Protein Information
putative RNA-binding protein Luc7-like 1
UniProt Protein Name
Putative RNA-binding protein Luc7-like 1
Protein Family
UniProt Gene Name
LUC7L
UniProt Synonym Gene Names
LUC7L1
UniProt Entry Name
LUC7L_HUMAN
NCBI Description
The LUC7L gene may represent a mammalian heterochromatic gene, encoding a putative RNA-binding protein similar to the yeast Luc7p subunit of the U1 snRNP splicing complex that is normally required for 5-prime splice site selection (Tufarelli et al., 2001 [PubMed 11170747]).[supplied by OMIM, Mar 2008]
Uniprot Description
LUC7L: May bind to RNA via its Arg/Ser-rich domain. Belongs to the Luc7 family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: C2H2-type zinc finger protein
Chromosomal Location of Human Ortholog: 16p13.3
Cellular Component: snRNP U1
Molecular Function: identical protein binding; mRNA binding; protein binding
Biological Process: mRNA splice site selection
Research Articles on LUC7L
Similar Products
Product Notes
The LUC7L luc7l (Catalog #AAA1278770) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcagatgg gagacgaaac cagacagagg gtcaagttta cagatgaccg tgtctgcaag agtcaccttc tggactgctg cccccatgac atcctggctg ggacgcgcat ggatttagga gaatgtacca aaatccacga cttggccctc cgagcagatt atgagattgc aagtaaagaa agagacctgt tttttgaatt agatgcaatg gatcacttgg agtcctttat tgctgaatgt gatcggagaa ctgagctcgc caagaagcgg ctggcagaaa cacaggagga aatcagtgcg gaagtttctg caaaggcaga aaaagtacat gagttaaatg aagaaatagg aaaactcctt gctaaagccg aacagctagg ggctgaaggt aatgtggatg aatcccagaa gattcttatg gaagtggaaa aagttcgtgc gaagaaaaaa gaagctgagg aagaatacag aaattccatg cctgcatcca gttttcagca gcaaaagctg cgtgtctgcg aggtctgttc agcctacctt ggtctccatg acaatgaccg tcgcctggca gaccacttcg gtggcaagtt acacttgggg ttcattcaga tccgagagaa gcttgatcag ttgaggaaaa ctgtcgctga aaagcaggag aagagaaatc aggatcgctt gaggaggaga gaggagaggg aacgggagga gcgtctgagc aggaggtcgg gatcaagaac cagagatcgc aggaggtcac gctcccggga tcggcgtcgg aggcggtcaa gatctacctc ccgagagcga cggaaattgt cccggtcccg gtcccgagat agacatcggc gccaccgcag ccgttcccgg agccacagcc ggggacatcg tcgggcttcc cgggaccgaa gtgcgaaata caagttctcc agagagcggg catccagaga ggagtcctgg gagagcgggc ggagcgagcg agggcccccg gactggaggc ttgagagctc caacgggaag atggcttcac ggaggtcaga agagaaggag gccggcgaga tctga. It is sometimes possible for the material contained within the vial of "LUC7L, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
