Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LSAMP cdna clone

LSAMP cDNA Clone

Gene Names
LSAMP; LAMP; IGLON3
Synonyms
LSAMP; LSAMP cDNA Clone; LSAMP cdna clone
Ordering
For Research Use Only!
Sequence
atggtcaggagagttcagccggatcggaaacagttgccactggtcctactgagattgctctgccttcttcccacaggactgcctgttcgcagcgtggattttaaccgaggcacggacaacatcaccgtgaggcagggggacacagccatcctcaggtgcgttgtagaagacaagaactcaaaggtggcctggttgaaccgttctggcatcatttttgctggacatgacaagtggtctctggacccacgggttgagctggagaaacgccattctctggaatacagcctccgaatccagaaggtggatgtctatgatgagggttcctacacttgctcagttcagacacagcatgagcccaagacctcccaagtttacttgatcgtacaagtcccaccaaagatctccaatatctcctcggatgtcactgtgaatgagggcagcaacgtgactctggtctgcatggccaatggccgtcctgaacctgttatcacctggagacaccttacaccaactggaagggaatttgaaggagaagaagaatatctggagatccttggcatcaccagggagcagtcaggcaaatatgagtgcaaagctgccaacgaggtctcctcggcggatgtcaaacaagtcaaggtcactgtgaactatcctcccactatcacagaatccaagagcaatgaagccaccacaggacgacaagcttcactcaaatgtgaggcctcggcagtgcctgcacctgactttgagtggtaccgggatgacactaggataaatagtgccaatggccttgagattaagagcacggagggccagtcttccctgacggtgaccaacgtcactgaggagcactacggcaactacacctgtgtggctgccaacaagctgggggtcaccaatgccagcctagtccttttcagacctgggtcggtgagaggaataaatggatccatcagtctggccgtaccactgtggctgctggcagcatctctgctctgccttctcagcaaatgttaa
Sequence Length
1017
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
37,393 Da
NCBI Official Full Name
Homo sapiens limbic system-associated membrane protein, mRNA
NCBI Official Synonym Full Names
limbic system-associated membrane protein
NCBI Official Symbol
LSAMP
NCBI Official Synonym Symbols
LAMP; IGLON3
NCBI Protein Information
limbic system-associated membrane protein
UniProt Protein Name
Limbic system-associated membrane protein
UniProt Gene Name
LSAMP
UniProt Synonym Gene Names
IGLON3; LAMP; LSAMP
UniProt Entry Name
LSAMP_HUMAN

NCBI Description

This gene encodes a member of the immunoglobulin LAMP, OBCAM and neurotrimin (IgLON) family of proteins. The encoded preproprotein is proteolytically processed to generate a neuronal surface glycoprotein. This protein may act as a selective homophilic adhesion molecule during axon guidance and neuronal growth in the developing limbic system. The encoded protein may also function as a tumor suppressor and may play a role in neuropsychiatric disorders. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. [provided by RefSeq, Jan 2016]

Uniprot Description

LSAMP: Mediates selective neuronal growth and axon targeting. Contributes to the guidance of developing axons and remodeling of mature circuits in the limbic system. Essential for normal growth of the hyppocampal mossy fiber projection. Belongs to the immunoglobulin superfamily. IgLON family.

Protein type: Membrane protein, GPI anchor

Chromosomal Location of Human Ortholog: 3q13.2-q21

Molecular Function: protein binding

Biological Process: nervous system development

Research Articles on LSAMP

Similar Products

Product Notes

The LSAMP lsamp (Catalog #AAA1268826) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtcagga gagttcagcc ggatcggaaa cagttgccac tggtcctact gagattgctc tgccttcttc ccacaggact gcctgttcgc agcgtggatt ttaaccgagg cacggacaac atcaccgtga ggcaggggga cacagccatc ctcaggtgcg ttgtagaaga caagaactca aaggtggcct ggttgaaccg ttctggcatc atttttgctg gacatgacaa gtggtctctg gacccacggg ttgagctgga gaaacgccat tctctggaat acagcctccg aatccagaag gtggatgtct atgatgaggg ttcctacact tgctcagttc agacacagca tgagcccaag acctcccaag tttacttgat cgtacaagtc ccaccaaaga tctccaatat ctcctcggat gtcactgtga atgagggcag caacgtgact ctggtctgca tggccaatgg ccgtcctgaa cctgttatca cctggagaca ccttacacca actggaaggg aatttgaagg agaagaagaa tatctggaga tccttggcat caccagggag cagtcaggca aatatgagtg caaagctgcc aacgaggtct cctcggcgga tgtcaaacaa gtcaaggtca ctgtgaacta tcctcccact atcacagaat ccaagagcaa tgaagccacc acaggacgac aagcttcact caaatgtgag gcctcggcag tgcctgcacc tgactttgag tggtaccggg atgacactag gataaatagt gccaatggcc ttgagattaa gagcacggag ggccagtctt ccctgacggt gaccaacgtc actgaggagc actacggcaa ctacacctgt gtggctgcca acaagctggg ggtcaccaat gccagcctag tccttttcag acctgggtcg gtgagaggaa taaatggatc catcagtctg gccgtaccac tgtggctgct ggcagcatct ctgctctgcc ttctcagcaa atgttaa. It is sometimes possible for the material contained within the vial of "LSAMP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.