LRRTM4 cdna clone
LRRTM4 cDNA Clone
Synonyms
LRRTM4; LRRTM4 cDNA Clone; LRRTM4 cdna clone
Sequence
atgtgggaatgcagtcggagcatttgtcctttattttattggcttaagaatttcaaaggaaataaggaaagcaccatgatatgtgcgggacctaagcacatccagggtgaaaaggttagtgatgcagtggaaacatataatatctgttctgaagtccaggtggtcaacacagaaagatcacacctggtgccccaaactccccagaaacctctgattatccctagacctaccatcttcaaacctgacgtcacccaatccacctttgaaacaccaagcccttccccagggtttcagattcctggcgcagagcaagagtatgagcatgtttcatttcacaaaattattgccgggagtgtggctctctttctctcagtggccatgatcctcttggtgatctatgtgtcttggaaacgctacccagccagcatgaaacaactccagcaacactctcttatgaagaggcggcggaaaaaggccagagagtctgaaagacaaatgaattcccctttacaggagtattatgtggactacaagcctacaaactctgagaccatggatatatcggttaatggatctgggccctgcacatataccatctctggctccagggaatgtgaggtatga
Sequence Length
624
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
59,126 Da
NCBI Official Full Name
Homo sapiens leucine rich repeat transmembrane neuronal 4, mRNA
NCBI Official Synonym Full Names
leucine rich repeat transmembrane neuronal 4
NCBI Official Symbol
LRRTM4
NCBI Protein Information
leucine-rich repeat transmembrane neuronal protein 4
UniProt Protein Name
Leucine-rich repeat transmembrane neuronal protein 4
Protein Family
UniProt Gene Name
LRRTM4
UniProt Entry Name
LRRT4_HUMAN
Uniprot Description
LRRTM4: May play a role in the development and maintenance of the vertebrate nervous system. Belongs to the LRRTM family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Cell development/differentiation; Membrane protein, integral
Chromosomal Location of Human Ortholog: 2p12
Cellular Component: cytoplasm
Molecular Function: protein kinase inhibitor activity
Biological Process: cytokine and chemokine mediated signaling pathway; negative regulation of JAK-STAT cascade; negative regulation of protein kinase activity
Research Articles on LRRTM4
Similar Products
Product Notes
The LRRTM4 lrrtm4 (Catalog #AAA1268470) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtgggaat gcagtcggag catttgtcct ttattttatt ggcttaagaa tttcaaagga aataaggaaa gcaccatgat atgtgcggga cctaagcaca tccagggtga aaaggttagt gatgcagtgg aaacatataa tatctgttct gaagtccagg tggtcaacac agaaagatca cacctggtgc cccaaactcc ccagaaacct ctgattatcc ctagacctac catcttcaaa cctgacgtca cccaatccac ctttgaaaca ccaagccctt ccccagggtt tcagattcct ggcgcagagc aagagtatga gcatgtttca tttcacaaaa ttattgccgg gagtgtggct ctctttctct cagtggccat gatcctcttg gtgatctatg tgtcttggaa acgctaccca gccagcatga aacaactcca gcaacactct cttatgaaga ggcggcggaa aaaggccaga gagtctgaaa gacaaatgaa ttccccttta caggagtatt atgtggacta caagcctaca aactctgaga ccatggatat atcggttaat ggatctgggc cctgcacata taccatctct ggctccaggg aatgtgaggt atga. It is sometimes possible for the material contained within the vial of "LRRTM4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
