Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LRMP cdna clone

LRMP cDNA Clone

Gene Names
LRMP; JAW1
Synonyms
LRMP; LRMP cDNA Clone; LRMP cdna clone
Ordering
For Research Use Only!
Sequence
atgaatgatgacccaagtatggaagagaatggtgttgaacgcgtgtgtcctgagagcctgctgcagtccagggaatattcctcactaccattacccagacacacttcatcgacagacggtactataacttcaagtgatcctggattagaaattctgaatatggcttcttgtgaccttgacagaaactcgctctgtaagaaagaggaggatacaagatcagcttctcccacgatagaggcccaaggcacaagtccagctcatgataatattgcattccaagactctacgagtaaggataaaaccatattaaatctggaagccaaagaggaaccagaaacaatagaagaacataaaaaagaacatgcttcaggagactctgtggtttcccctcttcctgtaaccactgtgaaatcggttaacgttagacaaagtgagaacacttctgctaatgagaaggaggtggaggcagaatttctcagattatctttgggatttaagtgtgactggtttaccttggagaagagagtgaagcttgaagagaggtcccgtgacttggcagaagaaaatttgaagaaagaaatcactaactctttaaaactattagagtctttaacacctctgtgtgaagatgacaaccaggcacaggaaatcattaagaagctggagaagagtataaagtttcttagccagtgtgcagcacgagtggccagtagggctgagatgttgggagccatcaatcaggaaagccgggttagtaaagcagttgaagtgatgattcagcacgtagaaaacttgaagaggatgtatgccaaagagcacgctgaattagaagaactgaaacaggttcttctgcagaatgaaaggtctttcaatcctcttgaagatgatgatgactgccaaattaaaaaacgttcagcttctctaaactccaagccatcttctctacgaagagtgactattgcctctttacccagaaatattggaaatgcaggaatggtggctgggatggaaaataatgatcgattcagtagaaggtcaagcagttggcgtattttggggtcaaagcagagtgaacaccgtccctcattacctcgatttattagcacctattcctgggcagatgctgaagaagaaaaatgtgaactaaaaactaaagatgactcagagccatctggagaagaaacagtagaaaggacaaggaagccaagtctttctgaaaagaaaaataatccatcaaagtgggatgtctcttcagtttatgacacaatagcttcctgggcaacaaatctcaagtcctccatcagaaaggctaataaggccctctggctctctattgcattcattgtactgtttgcagctttgatgagcttcctcacaggccaattattccagaagtctgtggatgccgctcccacacagcaagaggactcatggacgtctctagaacatatcttgtggccatttaccagactccgacacaatgggccaccaccagtgtga
Sequence Length
1500
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
56,213 Da
NCBI Official Full Name
Homo sapiens lymphoid-restricted membrane protein, mRNA
NCBI Official Synonym Full Names
lymphoid restricted membrane protein
NCBI Official Symbol
LRMP
NCBI Official Synonym Symbols
JAW1
NCBI Protein Information
lymphoid-restricted membrane protein
UniProt Protein Name
Lymphoid-restricted membrane protein
UniProt Gene Name
LRMP
UniProt Synonym Gene Names
JAW1
UniProt Entry Name
LRMP_HUMAN

NCBI Description

The protein encode dby this gene is expressed in a developmentally regulated manner in lymphoid cell lines and tissues. The protein is localized to the cytoplasmic face of the endoplasmic reticulum. [provided by RefSeq, Jul 2008]

Uniprot Description

LRMP: 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 12p12.1

Cellular Component: endoplasmic reticulum membrane; integral to membrane; integral to plasma membrane; membrane

Biological Process: vesicle fusion; vesicle targeting

Research Articles on LRMP

Similar Products

Product Notes

The LRMP lrmp (Catalog #AAA1270352) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaatgatg acccaagtat ggaagagaat ggtgttgaac gcgtgtgtcc tgagagcctg ctgcagtcca gggaatattc ctcactacca ttacccagac acacttcatc gacagacggt actataactt caagtgatcc tggattagaa attctgaata tggcttcttg tgaccttgac agaaactcgc tctgtaagaa agaggaggat acaagatcag cttctcccac gatagaggcc caaggcacaa gtccagctca tgataatatt gcattccaag actctacgag taaggataaa accatattaa atctggaagc caaagaggaa ccagaaacaa tagaagaaca taaaaaagaa catgcttcag gagactctgt ggtttcccct cttcctgtaa ccactgtgaa atcggttaac gttagacaaa gtgagaacac ttctgctaat gagaaggagg tggaggcaga atttctcaga ttatctttgg gatttaagtg tgactggttt accttggaga agagagtgaa gcttgaagag aggtcccgtg acttggcaga agaaaatttg aagaaagaaa tcactaactc tttaaaacta ttagagtctt taacacctct gtgtgaagat gacaaccagg cacaggaaat cattaagaag ctggagaaga gtataaagtt tcttagccag tgtgcagcac gagtggccag tagggctgag atgttgggag ccatcaatca ggaaagccgg gttagtaaag cagttgaagt gatgattcag cacgtagaaa acttgaagag gatgtatgcc aaagagcacg ctgaattaga agaactgaaa caggttcttc tgcagaatga aaggtctttc aatcctcttg aagatgatga tgactgccaa attaaaaaac gttcagcttc tctaaactcc aagccatctt ctctacgaag agtgactatt gcctctttac ccagaaatat tggaaatgca ggaatggtgg ctgggatgga aaataatgat cgattcagta gaaggtcaag cagttggcgt attttggggt caaagcagag tgaacaccgt ccctcattac ctcgatttat tagcacctat tcctgggcag atgctgaaga agaaaaatgt gaactaaaaa ctaaagatga ctcagagcca tctggagaag aaacagtaga aaggacaagg aagccaagtc tttctgaaaa gaaaaataat ccatcaaagt gggatgtctc ttcagtttat gacacaatag cttcctgggc aacaaatctc aagtcctcca tcagaaaggc taataaggcc ctctggctct ctattgcatt cattgtactg tttgcagctt tgatgagctt cctcacaggc caattattcc agaagtctgt ggatgccgct cccacacagc aagaggactc atggacgtct ctagaacata tcttgtggcc atttaccaga ctccgacaca atgggccacc accagtgtga. It is sometimes possible for the material contained within the vial of "LRMP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.