Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LPAR1 cdna clone

LPAR1 cDNA Clone

Gene Names
LPAR1; EDG2; LPA1; VZG1; GPR26; edg-2; vzg-1; Gpcr26; Mrec1.3; rec.1.3
Synonyms
LPAR1; LPAR1 cDNA Clone; LPAR1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaatgaaccacagtgcttctacaacgagtccattgccttcttttataaccgaagtggaaagcatcttgccacagaatggaacacagtcagcaagctggtgatgggacttggaatcactgtttgtatcttcatcatgttggccaacctattggtcatggtggcaatctatgtcaaccgccgcttccattttcctatttattacctaatggctaatctggctgctgcagacttctttgctgggttggcctacttctatctcatgttcaacacaggacccaatactcggagactgactgttagcacatggctccttcgtcagggcctcattgacaccagcctgacggcatctgtggccaacttactggctattgcaatcgagaggcacattacggttttccgcatgcagctccacacacggatgagcaaccggcgggtagtggtggtcattgtggtcatctggactatggccatcgttatgggtgctatacccagtgtgggctggaactgtatctgtgatattgaaaattgttccaacatggcacccctctacagtgactcttacttagtcttctgggccattttcaacttggtgacctttgtggtaatggtggttctctatgctcacatctttggctatgttcgccagaggactatgagaatgtctcggcatagttctggaccccggcggaatcgggataccatgatgagtcttctgaagactgtggtcattgtgcttggggcctttatcatctgctggactcctggattggttttgttacttctagacgtgtgctgtccacagtgcgacgtgctggcctatgagaaattcttccttctccttgctgaattcaactctgccatgaaccccatcatttactcctaccgcgacaaagaaatgagcgccacctttaggcagatcctctgctgccagcgcagtgagaaccccaccggccccacagaaggctcagaccgctcggcttcctccctcaaccacaccatcttggctggagttcacagcaatgaccactctgtggtttag
Sequence Length
1041
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
41,346 Da
NCBI Official Full Name
Homo sapiens lysophosphatidic acid receptor 1, mRNA
NCBI Official Synonym Full Names
lysophosphatidic acid receptor 1
NCBI Official Symbol
LPAR1
NCBI Official Synonym Symbols
EDG2; LPA1; VZG1; GPR26; edg-2; vzg-1; Gpcr26; Mrec1.3; rec.1.3
NCBI Protein Information
lysophosphatidic acid receptor 1
UniProt Protein Name
Lysophosphatidic acid receptor 1
UniProt Gene Name
LPAR1
UniProt Synonym Gene Names
EDG2; LPA1; LPA receptor 1; LPA-1
UniProt Entry Name
LPAR1_HUMAN

NCBI Description

The integral membrane protein encoded by this gene is a lysophosphatidic acid (LPA) receptor from a group known as EDG receptors. These receptors are members of the G protein-coupled receptor superfamily. Utilized by LPA for cell signaling, EDG receptors mediate diverse biologic functions, including proliferation, platelet aggregation, smooth muscle contraction, inhibition of neuroblastoma cell differentiation, chemotaxis, and tumor cell invasion. Two transcript variants encoding the same protein have been identified for this gene [provided by RefSeq, Jul 2008]

Uniprot Description

LPAR1: Receptor for lysophosphatidic acid (LPA), a mediator of diverse cellular activities. Seems to be coupled to the G(i)/G(o), G(12)/G(13), and G(q) families of heteromeric G proteins. Stimulates phospholipase C (PLC) activity in a manner that is dependent on RALA activation. Belongs to the G-protein coupled receptor 1 family.

Protein type: Membrane protein, multi-pass; Receptor, GPCR; GPCR, family 1; Membrane protein, integral

Chromosomal Location of Human Ortholog: 9q31.3

Cellular Component: cell surface; endocytic vesicle; endosome; integral to plasma membrane; plasma membrane

Molecular Function: G-protein coupled receptor activity; protein binding

Biological Process: elevation of cytosolic calcium ion concentration; elevation of cytosolic calcium ion concentration during G-protein signaling, coupled to IP3 second messenger (phospholipase C activating); G-protein coupled receptor protein signaling pathway; G-protein signaling, adenylate cyclase inhibiting pathway; phospholipase C activation; positive regulation of I-kappaB kinase/NF-kappaB cascade; positive regulation of MAPKKK cascade; positive regulation of Rho protein signal transduction; positive regulation of stress fiber formation; regulation of cell shape

Research Articles on LPAR1

Similar Products

Product Notes

The LPAR1 lpar1 (Catalog #AAA1278123) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaatgaac cacagtgctt ctacaacgag tccattgcct tcttttataa ccgaagtgga aagcatcttg ccacagaatg gaacacagtc agcaagctgg tgatgggact tggaatcact gtttgtatct tcatcatgtt ggccaaccta ttggtcatgg tggcaatcta tgtcaaccgc cgcttccatt ttcctattta ttacctaatg gctaatctgg ctgctgcaga cttctttgct gggttggcct acttctatct catgttcaac acaggaccca atactcggag actgactgtt agcacatggc tccttcgtca gggcctcatt gacaccagcc tgacggcatc tgtggccaac ttactggcta ttgcaatcga gaggcacatt acggttttcc gcatgcagct ccacacacgg atgagcaacc ggcgggtagt ggtggtcatt gtggtcatct ggactatggc catcgttatg ggtgctatac ccagtgtggg ctggaactgt atctgtgata ttgaaaattg ttccaacatg gcacccctct acagtgactc ttacttagtc ttctgggcca ttttcaactt ggtgaccttt gtggtaatgg tggttctcta tgctcacatc tttggctatg ttcgccagag gactatgaga atgtctcggc atagttctgg accccggcgg aatcgggata ccatgatgag tcttctgaag actgtggtca ttgtgcttgg ggcctttatc atctgctgga ctcctggatt ggttttgtta cttctagacg tgtgctgtcc acagtgcgac gtgctggcct atgagaaatt cttccttctc cttgctgaat tcaactctgc catgaacccc atcatttact cctaccgcga caaagaaatg agcgccacct ttaggcagat cctctgctgc cagcgcagtg agaaccccac cggccccaca gaaggctcag accgctcggc ttcctccctc aaccacacca tcttggctgg agttcacagc aatgaccact ctgtggttta g. It is sometimes possible for the material contained within the vial of "LPAR1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.