Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LIME1 cdna clone

LIME1 cDNA Clone

Gene Names
LIME1; LIME; dJ583P15.4
Synonyms
LIME1; LIME1 cDNA Clone; LIME1 cdna clone
Ordering
For Research Use Only!
Sequence
atggggctgccagtgtcctgggcccctcctgccctctgggttctagggtgctgcgccctgctcctctcgctgtgggcgctgtgcacagcctgccgcaggcccgaggacgctgtagcccccaggaagagggcgcggaggcagcgggcgaggctgcagggcagtgcgacggcggcggaagcgtccctactgaggcggacccacctctgctccctcagcaagtcggacaccagactgcacgagctgcaccggggcccgcgcagcagcagggccctgcggcctgccagcatggatctcctgcgcccacactggctggaggtgtccagggacatcaccggaccgcaggcagccccctctgccttcccacaccaggagctgccccgggctctgccggcagctgcagccaccgcagggtgcgctggcctcgaggccacctattccaacgtggggctggcggcccttcccggggtcagcctggcggccagccctgtggtggccgagtatgcccgcgtccagaagcgcaaagggacccatcgcagtccccaagagccacagcaggggaagactgaggtgaccccggccgctcaggtggacgtcctgtactccagggtctgcaagcctaaaaggagggacccaggacccaccacagacccgctggaccccaagggccagggagcgattctggccctggcgggtgacctggcctaccagaccctcccgctcagggccctggatgtggacagcggccccctggaaaacgtgtatgagagcatccgggagctgggggaccctgctggcaggagcagcacgtgcggggctgggacgccccctgcttccagctgccccagcctagggaggggctggagacccctccctgcctccctgccctga
Sequence Length
888
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
20,841 Da
NCBI Official Full Name
Homo sapiens Lck interacting transmembrane adaptor 1, mRNA
NCBI Official Synonym Full Names
Lck interacting transmembrane adaptor 1
NCBI Official Symbol
LIME1
NCBI Official Synonym Symbols
LIME; dJ583P15.4
NCBI Protein Information
lck-interacting transmembrane adapter 1
UniProt Protein Name
Lck-interacting transmembrane adapter 1
UniProt Gene Name
LIME1
UniProt Synonym Gene Names
LIME; Lck-interacting membrane protein
UniProt Entry Name
LIME1_HUMAN

NCBI Description

This gene encodes a transmembrane adaptor protein that links the T and B-cell receptor stimulation to downstream signaling pathways via its association with the Src family kinases Lck and Lyn, respectively. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Mar 2015]

Uniprot Description

LIME1: Involved in BCR (B-cell antigen receptor)-mediated signaling in B-cells and TCR (T-cell antigen receptor)-mediated T- cell signaling in T-cells. In absence of TCR signaling, may be involved in CD4-mediated inhibition of T-cell activation. Couples activation of these receptors and their associated kinases with distal intracellular events such as calcium mobilization or MAPK activation through the recruitment of PLCG2, GRB2, GRAP2, and other signaling molecules. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Adaptor/scaffold; Membrane protein, integral

Chromosomal Location of Human Ortholog: 20q13.3

Cellular Component: extracellular space

Research Articles on LIME1

Similar Products

Product Notes

The LIME1 lime1 (Catalog #AAA1268533) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggctgc cagtgtcctg ggcccctcct gccctctggg ttctagggtg ctgcgccctg ctcctctcgc tgtgggcgct gtgcacagcc tgccgcaggc ccgaggacgc tgtagccccc aggaagaggg cgcggaggca gcgggcgagg ctgcagggca gtgcgacggc ggcggaagcg tccctactga ggcggaccca cctctgctcc ctcagcaagt cggacaccag actgcacgag ctgcaccggg gcccgcgcag cagcagggcc ctgcggcctg ccagcatgga tctcctgcgc ccacactggc tggaggtgtc cagggacatc accggaccgc aggcagcccc ctctgccttc ccacaccagg agctgccccg ggctctgccg gcagctgcag ccaccgcagg gtgcgctggc ctcgaggcca cctattccaa cgtggggctg gcggcccttc ccggggtcag cctggcggcc agccctgtgg tggccgagta tgcccgcgtc cagaagcgca aagggaccca tcgcagtccc caagagccac agcaggggaa gactgaggtg accccggccg ctcaggtgga cgtcctgtac tccagggtct gcaagcctaa aaggagggac ccaggaccca ccacagaccc gctggacccc aagggccagg gagcgattct ggccctggcg ggtgacctgg cctaccagac cctcccgctc agggccctgg atgtggacag cggccccctg gaaaacgtgt atgagagcat ccgggagctg ggggaccctg ctggcaggag cagcacgtgc ggggctggga cgccccctgc ttccagctgc cccagcctag ggaggggctg gagacccctc cctgcctccc tgccctga. It is sometimes possible for the material contained within the vial of "LIME1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.