Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KRR1 cdna clone

KRR1 cDNA Clone

Gene Names
KRR1; HRB2; RIP-1
Synonyms
KRR1; KRR1 cDNA Clone; KRR1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgtctccctcgctggagcggccagaaaaaggcgctggaaaaagtgaatttcgtaaccagaagccgaagccggagaaccaagatgaatcagaactccttacggttcctgatggttggaaggaaccagctttttccaaagaggacaatcccagaggacttttggaggagagcagtttcgcaactttgttcccaaaatacaggggagcttacttgaaagagtgttggccattggtgcagaaagccttaaatgaacatcatgttaatgcaaccctggacctgatcgaaggcagcatgactgtttgtactacaaagaagacttttgatccatatatcatcattagggccagagatctgataaaactgttagcaaggagtgtttcatttgaacaggcagtacgaattcttcaggatgatgttgcatgtgacatcattaaaataggttctttagtaaggaataaagagagatttgtaaaacgaagacaacggcttattggtcccaaaggatctacattgaaggcattggaactcttaactaattgttacattatggttcagggaaacacagtttcagccattggaccttttagtggcttaaaagaggttagaaaagtagtccttgatactatgaagaatattcatccaatttataacattaaaagcttaatgattaagagagagttggcaaaagattctgaattacgatcacaaagttgggagagatttttgccacagttcaaacacaaaaatgtgaataaacgcaaggaaccaaagaaaaaaactgttaagaaagaatatacgccattcccaccaccacaaccagaaagtcagatcgataaagaattggctagtggtgaatactttttgaaggcaaatcagaagaagcggcagaaaatggaagcaataaaggctaaacaagcagaagccatcagtaagagacaagaggaaagaaacaaagcatttattccacctaaggaaaaaccaattgtgaaacctaaggaagcttctactgaaactaaaattgatgtggccagcatcaaggaaaaggttaagaaagcaaagaataagaaactgggagctcttacagctgaagaaattgcacttaagatggaggcagatgaaaagaaaaagaagaaaaaaaagtaa
Sequence Length
1146
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
36,788 Da
NCBI Official Full Name
Homo sapiens KRR1, small subunit (SSU) processome component, homolog (yeast), mRNA
NCBI Official Synonym Full Names
KRR1, small subunit processome component homolog
NCBI Official Symbol
KRR1
NCBI Official Synonym Symbols
HRB2; RIP-1
NCBI Protein Information
KRR1 small subunit processome component homolog
UniProt Protein Name
KRR1 small subunit processome component homolog
UniProt Gene Name
KRR1
UniProt Synonym Gene Names
HRB2; Rip-1
UniProt Entry Name
KRR1_HUMAN

Uniprot Description

KRR1: Required for 40S ribosome biogenesis. Involved in nucleolar processing of pre-18S ribosomal RNA and ribosome assembly. Belongs to the KRR1 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: RNA processing; Nucleolus

Chromosomal Location of Human Ortholog: 12q21.2

Cellular Component: intercellular bridge; membrane; nucleolus; nucleoplasm; nucleus; small subunit processome

Molecular Function: protein binding

Biological Process: maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA); rRNA processing

Research Articles on KRR1

Similar Products

Product Notes

The KRR1 krr1 (Catalog #AAA1271104) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgtctc cctcgctgga gcggccagaa aaaggcgctg gaaaaagtga atttcgtaac cagaagccga agccggagaa ccaagatgaa tcagaactcc ttacggttcc tgatggttgg aaggaaccag ctttttccaa agaggacaat cccagaggac ttttggagga gagcagtttc gcaactttgt tcccaaaata caggggagct tacttgaaag agtgttggcc attggtgcag aaagccttaa atgaacatca tgttaatgca accctggacc tgatcgaagg cagcatgact gtttgtacta caaagaagac ttttgatcca tatatcatca ttagggccag agatctgata aaactgttag caaggagtgt ttcatttgaa caggcagtac gaattcttca ggatgatgtt gcatgtgaca tcattaaaat aggttcttta gtaaggaata aagagagatt tgtaaaacga agacaacggc ttattggtcc caaaggatct acattgaagg cattggaact cttaactaat tgttacatta tggttcaggg aaacacagtt tcagccattg gaccttttag tggcttaaaa gaggttagaa aagtagtcct tgatactatg aagaatattc atccaattta taacattaaa agcttaatga ttaagagaga gttggcaaaa gattctgaat tacgatcaca aagttgggag agatttttgc cacagttcaa acacaaaaat gtgaataaac gcaaggaacc aaagaaaaaa actgttaaga aagaatatac gccattccca ccaccacaac cagaaagtca gatcgataaa gaattggcta gtggtgaata ctttttgaag gcaaatcaga agaagcggca gaaaatggaa gcaataaagg ctaaacaagc agaagccatc agtaagagac aagaggaaag aaacaaagca tttattccac ctaaggaaaa accaattgtg aaacctaagg aagcttctac tgaaactaaa attgatgtgg ccagcatcaa ggaaaaggtt aagaaagcaa agaataagaa actgggagct cttacagctg aagaaattgc acttaagatg gaggcagatg aaaagaaaaa gaagaaaaaa aagtaa. It is sometimes possible for the material contained within the vial of "KRR1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.