KRCC1 cdna clone
KRCC1 cDNA Clone
Gene Names
KRCC1; CHBP2
Synonyms
KRCC1; KRCC1 cDNA Clone; KRCC1 cdna clone
Sequence
atgaagcattcaaagaagacatatgactcttttcaagatgaacttgaagattatattaaagtacagaaagccagaggcttagagccaaagacttgtttcagaaagatgaaaggggactatttggaaacctgtgggtacaaaggagaggttaattccagacccacgtatagaatgtttgaccagagactcccatctgaaaccatccagacctacccaagatcatgcaatattccacaaacagtggaaaatcggttgcctcagtggttaccagcccatgacagcagattgagactagactctctgagctactgtcagttcacgagggactgtttctcagaaaaaccagtacccctgaactttaatcaacaagaatatatttgtggctcacatggtgtagaacatagagtttacaagcacttctcctcagataacagtaccagtactcatcaagccagtcacaaacagatacatcagaagaggaaaaggcacccagaggaaggcagagaaaaatcagaggaggagcggtctaagcataagagaaaaaaaagctgcgaggaaattgacttagacaaacacaagagcatccaaagaaagaaaacagaggtggaaatagaaaccgtacatgtcagtacagaaaagcttaagaatcgaaaggagaaaaaaagccgagatgtagtctctaagaaagaggaacgtaagcgtacaaaaaagaaaaaggaacaaggccaagaaaggacagaggaggaaatgctttgggaccagtctattcttggattttga
Sequence Length
780
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
30,980 Da
NCBI Official Full Name
Homo sapiens lysine-rich coiled-coil 1, mRNA
NCBI Official Synonym Full Names
lysine rich coiled-coil 1
NCBI Official Symbol
KRCC1
NCBI Official Synonym Symbols
CHBP2
NCBI Protein Information
lysine-rich coiled-coil protein 1
UniProt Protein Name
Lysine-rich coiled-coil protein 1
Protein Family
UniProt Gene Name
KRCC1
UniProt Synonym Gene Names
CHBP2
UniProt Entry Name
KRCC1_HUMAN
Uniprot Description
KRCC1:
Chromosomal Location of Human Ortholog: 2p11.2
Similar Products
Product Notes
The KRCC1 krcc1 (Catalog #AAA1278322) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagcatt caaagaagac atatgactct tttcaagatg aacttgaaga ttatattaaa gtacagaaag ccagaggctt agagccaaag acttgtttca gaaagatgaa aggggactat ttggaaacct gtgggtacaa aggagaggtt aattccagac ccacgtatag aatgtttgac cagagactcc catctgaaac catccagacc tacccaagat catgcaatat tccacaaaca gtggaaaatc ggttgcctca gtggttacca gcccatgaca gcagattgag actagactct ctgagctact gtcagttcac gagggactgt ttctcagaaa aaccagtacc cctgaacttt aatcaacaag aatatatttg tggctcacat ggtgtagaac atagagttta caagcacttc tcctcagata acagtaccag tactcatcaa gccagtcaca aacagataca tcagaagagg aaaaggcacc cagaggaagg cagagaaaaa tcagaggagg agcggtctaa gcataagaga aaaaaaagct gcgaggaaat tgacttagac aaacacaaga gcatccaaag aaagaaaaca gaggtggaaa tagaaaccgt acatgtcagt acagaaaagc ttaagaatcg aaaggagaaa aaaagccgag atgtagtctc taagaaagag gaacgtaagc gtacaaaaaa gaaaaaggaa caaggccaag aaaggacaga ggaggaaatg ctttgggacc agtctattct tggattttga. It is sometimes possible for the material contained within the vial of "KRCC1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
