KLF3 cdna clone
KLF3 cDNA Clone
Gene Names
KLF3; BKLF
Synonyms
KLF3; KLF3 cDNA Clone; KLF3 cdna clone
Sequence
atgctcatgtttgacccagttcctgtcaagcaagaggccatggaccctgtctcagtgtcatacccatctaattacatggaatccatgaagcctaacaagtatggggtcatctactccacaccattgcctgagaagttctttcagaccccagaaggtctgtcgcacggaatacagatggagccagtggacctcacggtgaacaagcggagttcacccccttcggctgggaattcgccctcctctctgaagttcccgtcctcacaccggagagcctcgcctgggttgagcatgccttcttccagcccaccgataaaaaaatactcacccccttctccaggcgtgcagcccttcggcgtgccgctgtccatgccaccagtgatggcagctgccctctcgcggcatggaatacggagcccggggatcctgcccgtcatccagccggtggtggtgcagcccgtcccctttatgtacacaagtcacctccagcagcctctcatggtctccttatcggaggagatggaaaattccagtagtagcatgcaagtacctgtaattgaatcatatgagaagcctatatcacagaaaaaaattaaaatagaacctgggatcgaaccacagaggacagattattatcctgaagaaatgtcaccccccttaatgaactcagtgtcccccccgcaagcattgttgcaagagaatcacccttcggtcatcgtgcagcctgggaagagacctttacctgtggaatccccggatactcaaaggaagcggaggatacacagatgtgattatgatggatgcaacaaagtgtacactaaaagctcccacttgaaagcacacagaagaacacacacaggagaaaaaccctacaaatgtacatgggaagggtgcacatggaagtttgctcggtctggtgaactaacaagacatttccgaaaacatactggaatcaaacctttccagtgcccggactgtgaccgcagcttctcccgttctgaccatcttgccctccataggaaacgccacatgctagtctga
Sequence Length
1038
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
25,430 Da
NCBI Official Full Name
Homo sapiens Kruppel-like factor 3 (basic), mRNA
NCBI Official Synonym Full Names
Kruppel like factor 3
NCBI Official Symbol
KLF3
NCBI Official Synonym Symbols
BKLF
NCBI Protein Information
Krueppel-like factor 3
UniProt Protein Name
Krueppel-like factor 3
Protein Family
UniProt Gene Name
KLF3
UniProt Synonym Gene Names
BKLF
UniProt Entry Name
KLF3_HUMAN
Uniprot Description
KLF3: Binds to the CACCC box of erythroid cell-expressed genes. May play a role in hematopoiesis. Belongs to the krueppel C2H2-type zinc-finger protein family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Transcription factor; DNA-binding; C2H2-type zinc finger protein
Chromosomal Location of Human Ortholog: 4p14
Molecular Function: protein binding
Biological Process: multicellular organismal development
Research Articles on KLF3
Similar Products
Product Notes
The KLF3 klf3 (Catalog #AAA1278701) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctcatgt ttgacccagt tcctgtcaag caagaggcca tggaccctgt ctcagtgtca tacccatcta attacatgga atccatgaag cctaacaagt atggggtcat ctactccaca ccattgcctg agaagttctt tcagacccca gaaggtctgt cgcacggaat acagatggag ccagtggacc tcacggtgaa caagcggagt tcaccccctt cggctgggaa ttcgccctcc tctctgaagt tcccgtcctc acaccggaga gcctcgcctg ggttgagcat gccttcttcc agcccaccga taaaaaaata ctcaccccct tctccaggcg tgcagccctt cggcgtgccg ctgtccatgc caccagtgat ggcagctgcc ctctcgcggc atggaatacg gagcccgggg atcctgcccg tcatccagcc ggtggtggtg cagcccgtcc cctttatgta cacaagtcac ctccagcagc ctctcatggt ctccttatcg gaggagatgg aaaattccag tagtagcatg caagtacctg taattgaatc atatgagaag cctatatcac agaaaaaaat taaaatagaa cctgggatcg aaccacagag gacagattat tatcctgaag aaatgtcacc ccccttaatg aactcagtgt cccccccgca agcattgttg caagagaatc acccttcggt catcgtgcag cctgggaaga gacctttacc tgtggaatcc ccggatactc aaaggaagcg gaggatacac agatgtgatt atgatggatg caacaaagtg tacactaaaa gctcccactt gaaagcacac agaagaacac acacaggaga aaaaccctac aaatgtacat gggaagggtg cacatggaag tttgctcggt ctggtgaact aacaagacat ttccgaaaac atactggaat caaacctttc cagtgcccgg actgtgaccg cagcttctcc cgttctgacc atcttgccct ccataggaaa cgccacatgc tagtctga. It is sometimes possible for the material contained within the vial of "KLF3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
