Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KIAA0317 cdna clone

KIAA0317 cDNA Clone

Gene Names
AREL1; FIEL1; KIAA0317
Synonyms
KIAA0317; KIAA0317 cDNA Clone; KIAA0317 cdna clone
Ordering
For Research Use Only!
Sequence
atgttttacgttattggtgggatcacagtgtctgtggttgcattcttcttcacaattaagttcctctttgagcttgccgcacgtgtagtcagcttcctccagaatgaggaccgcgagcgccgaggggaccggactatttatgactacgtgcggggaaattacctggatccccggtcttgcaaagtctcctgggattggaaggacccctatgaggtgggccacagcatggccttccgagtgcatttattctataagaacgggcagcctttccctgcacatcggcctgtgggactaagagttcacatctctcatgtcgagctagcagtggaaattccagtgaaccaggaagtccttcaggagcccaattccaacgtagtaaaagtggccttcactgtgcgcaaggctgggcgttatgaaatcacagtgaagcttggtggattaaatgtggcatatagtccctactacaaaatttttcaacctggaatggtggttccttctaagaccaaaattgtgtgccacttttctactcttgtattgacctgtgggcagccgcacacccttcaaatagtaccccgagatgagtatgataatcccaccaacaattccatgtccttgagagatgagcacaattacaccttgtccattcatgagctcggccctcaagaagaagagagtactggtgtctcatttgagaaatcagtaacatccaacaggcagactttccaggtgttcttgcgactcaccctgcattctcgaggctgcttccatgcttgcatttcataccaaaatcagccaatcaataatggtgaatttgacattattgtcctaagtgaggatgagaagaatatcgtcgaacgcaatgtgtccacttcaggcgtgagcatttactttgaggcttatctttataatgctaccaactgtagcagcactccatggcacctgccacccatgcacatgacctcttcccagcgccggccatccactgctgttgacgaggaagatgaagactcgccctctgagtgccacacccctgagaaggtgaagaaaccgaagaaggtgtactgctatgtgtcaccaaagcaattctcagtgaaggagttctacctgaagatcatccactggcgcctttacaccttccgagtgtgtccaggaacaaaattttcataccttggtcctgaccctgtccataagctgctcacactggtggtggatgatggcattcaacctcctgtggagctcagctgtaaggagaggaacattctagcagccacttttatccgctccctgcataagaacataggaggctctgagacctttcaggacaaggtgaactttttccagcgagagcttcggcaggtacatatgaaaagaccacattccaaagtcaccctgaaggtcagcagacatgccttgttggaatcgtctctgaaagccactcggaatttctccatctcagattggagcaagaactttgaggttgttttccaggatgaagaagctctggactggggagggcctcgccgggaatggtttgagctaatctgcaaagcactatttgatacaaccaatcagctcttcacccggttcagtgacaacaaccaagcattagtgcatcccaaccctaatcgccccgctcatctgcgcctgaaaatgtatgagtttgcgggacggctcgtgggcaagtgtctctatgagtcctctctaggaggagcctacaagcagttggtccgagctcgcttcacccgctctttcctggcccaaatcataggactgcgtatgcattacaagtactttgaaacagatgacccagaattctacaaatctaaagtttgttttatcctcaacaatgacatgagtgagatggagctggtctttgcagaagagaaatataataaatcaggtcaattggataaggttgtagaactcatgacaggtggagctcaaactccagtcaccaatgcgaataaaatcttctatttaaatttgctggcccaatatcggctggccagtcaagtgaaagaggaggtggaacatttcctaaaaggcctgaatgaattggtccctgagaaccttttggctatttttgatgagaatgagcttgagctgctgatgtgtgggactggagacatcagtgtgtctgacttcaaagcccatgcagtagttgttggtggctcatggcatttcagagaaaaggtcatgaggtggttttggactgtggtttccagtctgacccaggaggagttggctcggctacttcagttcacaacaggctcctctcagctaccacctggaggctttgccgccctctgtccctcatttcagattattgccgctccgacccatagcacgctgcctactgcacacacatga
Sequence Length
2370
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
90,342 Da
NCBI Official Full Name
Homo sapiens KIAA0317, mRNA
NCBI Official Synonym Full Names
apoptosis resistant E3 ubiquitin protein ligase 1
NCBI Official Symbol
AREL1
NCBI Official Synonym Symbols
FIEL1; KIAA0317
NCBI Protein Information
apoptosis-resistant E3 ubiquitin protein ligase 1
UniProt Protein Name
Apoptosis-resistant E3 ubiquitin protein ligase 1
UniProt Gene Name
AREL1
UniProt Synonym Gene Names
KIAA0317
UniProt Entry Name
AREL1_HUMAN

Uniprot Description

AREL1: 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 14q24.3

Cellular Component: cytosol; nucleus

Molecular Function: ubiquitin-protein ligase activity

Biological Process: negative regulation of apoptosis; protein ubiquitination during ubiquitin-dependent protein catabolic process

Research Articles on KIAA0317

Similar Products

Product Notes

The KIAA0317 arel1 (Catalog #AAA1274501) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttttacg ttattggtgg gatcacagtg tctgtggttg cattcttctt cacaattaag ttcctctttg agcttgccgc acgtgtagtc agcttcctcc agaatgagga ccgcgagcgc cgaggggacc ggactattta tgactacgtg cggggaaatt acctggatcc ccggtcttgc aaagtctcct gggattggaa ggacccctat gaggtgggcc acagcatggc cttccgagtg catttattct ataagaacgg gcagcctttc cctgcacatc ggcctgtggg actaagagtt cacatctctc atgtcgagct agcagtggaa attccagtga accaggaagt ccttcaggag cccaattcca acgtagtaaa agtggccttc actgtgcgca aggctgggcg ttatgaaatc acagtgaagc ttggtggatt aaatgtggca tatagtccct actacaaaat ttttcaacct ggaatggtgg ttccttctaa gaccaaaatt gtgtgccact tttctactct tgtattgacc tgtgggcagc cgcacaccct tcaaatagta ccccgagatg agtatgataa tcccaccaac aattccatgt ccttgagaga tgagcacaat tacaccttgt ccattcatga gctcggccct caagaagaag agagtactgg tgtctcattt gagaaatcag taacatccaa caggcagact ttccaggtgt tcttgcgact caccctgcat tctcgaggct gcttccatgc ttgcatttca taccaaaatc agccaatcaa taatggtgaa tttgacatta ttgtcctaag tgaggatgag aagaatatcg tcgaacgcaa tgtgtccact tcaggcgtga gcatttactt tgaggcttat ctttataatg ctaccaactg tagcagcact ccatggcacc tgccacccat gcacatgacc tcttcccagc gccggccatc cactgctgtt gacgaggaag atgaagactc gccctctgag tgccacaccc ctgagaaggt gaagaaaccg aagaaggtgt actgctatgt gtcaccaaag caattctcag tgaaggagtt ctacctgaag atcatccact ggcgccttta caccttccga gtgtgtccag gaacaaaatt ttcatacctt ggtcctgacc ctgtccataa gctgctcaca ctggtggtgg atgatggcat tcaacctcct gtggagctca gctgtaagga gaggaacatt ctagcagcca cttttatccg ctccctgcat aagaacatag gaggctctga gacctttcag gacaaggtga actttttcca gcgagagctt cggcaggtac atatgaaaag accacattcc aaagtcaccc tgaaggtcag cagacatgcc ttgttggaat cgtctctgaa agccactcgg aatttctcca tctcagattg gagcaagaac tttgaggttg ttttccagga tgaagaagct ctggactggg gagggcctcg ccgggaatgg tttgagctaa tctgcaaagc actatttgat acaaccaatc agctcttcac ccggttcagt gacaacaacc aagcattagt gcatcccaac cctaatcgcc ccgctcatct gcgcctgaaa atgtatgagt ttgcgggacg gctcgtgggc aagtgtctct atgagtcctc tctaggagga gcctacaagc agttggtccg agctcgcttc acccgctctt tcctggccca aatcatagga ctgcgtatgc attacaagta ctttgaaaca gatgacccag aattctacaa atctaaagtt tgttttatcc tcaacaatga catgagtgag atggagctgg tctttgcaga agagaaatat aataaatcag gtcaattgga taaggttgta gaactcatga caggtggagc tcaaactcca gtcaccaatg cgaataaaat cttctattta aatttgctgg cccaatatcg gctggccagt caagtgaaag aggaggtgga acatttccta aaaggcctga atgaattggt ccctgagaac cttttggcta tttttgatga gaatgagctt gagctgctga tgtgtgggac tggagacatc agtgtgtctg acttcaaagc ccatgcagta gttgttggtg gctcatggca tttcagagaa aaggtcatga ggtggttttg gactgtggtt tccagtctga cccaggagga gttggctcgg ctacttcagt tcacaacagg ctcctctcag ctaccacctg gaggctttgc cgccctctgt ccctcatttc agattattgc cgctccgacc catagcacgc tgcctactgc acacacatga. It is sometimes possible for the material contained within the vial of "KIAA0317, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.