Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KCNS3 cdna clone

KCNS3 cDNA Clone

Gene Names
KCNS3; KV9.3
Synonyms
KCNS3; KCNS3 cDNA Clone; KCNS3 cdna clone
Ordering
For Research Use Only!
Sequence
atggtgtttggtgagtttttccatcgccctggacaagacgaggaacttgtcaacctgaatgtggggggctttaagcagtctgttgaccaaagcaccctcctgcggtttcctcacaccagactggggaagctgcttacttgccattctgaagaggccattctggagctgtgtgatgattacagtgtggccgataaggaatactactttgatcggaatccctccttgttcagatatgttttgaatttttattacacggggaagctgcatgtcatggaggagctgtgcgtattctcattctgccaggagatcgagtactggggcatcaacgagctcttcattgattcttgctgcagcaatcgctaccaggaacgcaaggaggaaaaccacgagaaggactgggaccagaaaagccatgatgtgagtaccgactcctcgtttgaagagtcgtctctgtttgagaaagagctggagaagtttgacacactgcgatttggtcagctccggaagaaaatctggattagaatggagaatccagcgtactgcctgtccgctaagcttatcgctatctcctccttgagcgtggtgctggcctccatcgtggccatgtgcgttcacagcatgtcggagttccagaatgaggatggagaagtggatgatccggtgctggaaggattggagatcgcgtgcattgcctggttcaccggggagcttgccgtccggctggctgccgctccttgtcaaaagaaattctggaaaaaccctctgaacatcattgactttgtctctattattcccttctatgccacgttggctgtagacaccaaggaggaagagagtgaggatattgagaacatgggcaaggtggtccagatcctacggcttatgaggattttccgaattctaaagcttgcccggcactcggtaggacttcggtctctaggtgccacactgagacacagctaccatgaagttgggcttctgcttctcttcctctctgtgggcatttccattttctctgtgcttatctactccgtggagaaagatgaccacacatccagcctcaccagcatccccatctgctggtggtgggccaccatcagcatgacaactgtgggctatggagacacccacccggtcaccttggcgggaaagctcatcgccagcacatgcatcatctgtggcatcttggtggtggcccttcccatcaccatcatcttcaacaagttttccaagtactaccagaagcaaaaggacattgatgtggaccagtgcagtgaggatgcaccagagaagtgtcatgagctaccttactttaacattagggatatatatgcacagcggatgcacgccttcattaccagtctctcttctgtaggcattgtggtgagcgatcctgactccacagatgcttcaagcattgaagacaatgaggacatttgtaacaccacctccttggagaattgcacagcaaaatga
Sequence Length
1476
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
56,001 Da
NCBI Official Full Name
Homo sapiens potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3, mRNA
NCBI Official Synonym Full Names
potassium voltage-gated channel modifier subfamily S member 3
NCBI Official Symbol
KCNS3
NCBI Official Synonym Symbols
KV9.3
NCBI Protein Information
potassium voltage-gated channel subfamily S member 3
UniProt Protein Name
Potassium voltage-gated channel subfamily S member 3
UniProt Gene Name
KCNS3
UniProt Entry Name
KCNS3_HUMAN

NCBI Description

Voltage-gated potassium channels form the largest and most diversified class of ion channels and are present in both excitable and nonexcitable cells. Their main functions are associated with the regulation of the resting membrane potential and the control of the shape and frequency of action potentials. The alpha subunits are of 2 types: those that are functional by themselves and those that are electrically silent but capable of modulating the activity of specific functional alpha subunits. The protein encoded by this gene is not functional by itself but can form heteromultimers with member 1 and with member 2 (and possibly other members) of the Shab-related subfamily of potassium voltage-gated channel proteins. This gene belongs to the S subfamily of the potassium channel family. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2013]

Uniprot Description

Kv9.3: Potassium channel subunit. Modulates channel activity and reduces the ion flow. Belongs to the potassium channel family. S (TC 1.A.1.2) subfamily. Kv9.3/KCNS3 sub-subfamily.

Protein type: Membrane protein, multi-pass; Membrane protein, integral

Chromosomal Location of Human Ortholog: 2p24

Cellular Component: cytoplasm; Golgi apparatus; integral to membrane; plasma membrane

Molecular Function: delayed rectifier potassium channel activity; potassium channel regulator activity

Biological Process: potassium ion transport; regulation of insulin secretion

Research Articles on KCNS3

Similar Products

Product Notes

The KCNS3 kcns3 (Catalog #AAA1268643) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgtttg gtgagttttt ccatcgccct ggacaagacg aggaacttgt caacctgaat gtggggggct ttaagcagtc tgttgaccaa agcaccctcc tgcggtttcc tcacaccaga ctggggaagc tgcttacttg ccattctgaa gaggccattc tggagctgtg tgatgattac agtgtggccg ataaggaata ctactttgat cggaatccct ccttgttcag atatgttttg aatttttatt acacggggaa gctgcatgtc atggaggagc tgtgcgtatt ctcattctgc caggagatcg agtactgggg catcaacgag ctcttcattg attcttgctg cagcaatcgc taccaggaac gcaaggagga aaaccacgag aaggactggg accagaaaag ccatgatgtg agtaccgact cctcgtttga agagtcgtct ctgtttgaga aagagctgga gaagtttgac acactgcgat ttggtcagct ccggaagaaa atctggatta gaatggagaa tccagcgtac tgcctgtccg ctaagcttat cgctatctcc tccttgagcg tggtgctggc ctccatcgtg gccatgtgcg ttcacagcat gtcggagttc cagaatgagg atggagaagt ggatgatccg gtgctggaag gattggagat cgcgtgcatt gcctggttca ccggggagct tgccgtccgg ctggctgccg ctccttgtca aaagaaattc tggaaaaacc ctctgaacat cattgacttt gtctctatta ttcccttcta tgccacgttg gctgtagaca ccaaggagga agagagtgag gatattgaga acatgggcaa ggtggtccag atcctacggc ttatgaggat tttccgaatt ctaaagcttg cccggcactc ggtaggactt cggtctctag gtgccacact gagacacagc taccatgaag ttgggcttct gcttctcttc ctctctgtgg gcatttccat tttctctgtg cttatctact ccgtggagaa agatgaccac acatccagcc tcaccagcat ccccatctgc tggtggtggg ccaccatcag catgacaact gtgggctatg gagacaccca cccggtcacc ttggcgggaa agctcatcgc cagcacatgc atcatctgtg gcatcttggt ggtggccctt cccatcacca tcatcttcaa caagttttcc aagtactacc agaagcaaaa ggacattgat gtggaccagt gcagtgagga tgcaccagag aagtgtcatg agctacctta ctttaacatt agggatatat atgcacagcg gatgcacgcc ttcattacca gtctctcttc tgtaggcatt gtggtgagcg atcctgactc cacagatgct tcaagcattg aagacaatga ggacatttgt aacaccacct ccttggagaa ttgcacagca aaatga. It is sometimes possible for the material contained within the vial of "KCNS3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.