Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KCNK6 cdna clone

KCNK6 cDNA Clone

Gene Names
KCNK6; TOSS; KCNK8; TWIK2; K2p6.1; TWIK-2
Synonyms
KCNK6; KCNK6 cDNA Clone; KCNK6 cdna clone
Ordering
For Research Use Only!
Sequence
atgcggaggggcgcgcttctggcgggcgccttggccgcgtacgccgcgtacctggtgctgggcgcgctgttggtggcgcggctggaggggccgcacgaagccaggctccgagccgagctggagacgctgcgggcgcagctgcttcagcgcagcccgtgtgtggctgcccccgccctggacgccttcgtggagcgagtgctggcggccggacggctggggcgggtcgtgcttgctaacgcttcggggtccgccaacgcctcggaccccgcctgggacttcgcctctgctctcttcttcgccagcacgctgatcaccaccgtgggctatgggtacacaacgccactgactgatgcgggcaaggccttctccatcgcctttgcgctcctgggcgtgccgaccaccatgctgctgctgaccgcctcagcccagcgcctgtcactgctgctgactcacgtgcccctgtcttggctgagcatgcgttggggctgggacccccggcgggcggcctgctggcacttggtggccctgttgggggtcgtagtgaccgtctgctttctggtgccggctgtgatctttgcccacctcgaggaggcctggagcttcttggatgccttctacttctgctttatctctctgtccaccatcggcctgggcgactacgtgcccggggaggcccctggccagccctaccgggccctctacaaggtgctggtcacagtctacctcttcctgggcctggtggccatggtgctggtgctgcagaccttccgccacgtgtccgacctccacggcctcacggagctcatcctgctgccccctccgtgccctgccagtttcaatgcggatgaggacgatcgggtggacatcctgggcccccagccggagtcgcaccagcaactctctgccagctcccacaccgactacgcttccatccccaggtag
Sequence Length
942
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
19,903 Da
NCBI Official Full Name
Homo sapiens potassium channel, subfamily K, member 6, mRNA
NCBI Official Synonym Full Names
potassium two pore domain channel subfamily K member 6
NCBI Official Symbol
KCNK6
NCBI Official Synonym Symbols
TOSS; KCNK8; TWIK2; K2p6.1; TWIK-2
NCBI Protein Information
potassium channel subfamily K member 6
UniProt Protein Name
Potassium channel subfamily K member 6
UniProt Gene Name
KCNK6
UniProt Synonym Gene Names
TOSS; TWIK2
UniProt Entry Name
KCNK6_HUMAN

NCBI Description

This gene encodes one of the members of the superfamily of potassium channel proteins containing two pore-forming P domains. This channel protein, considered an open rectifier, is widely expressed. It is stimulated by arachidonic acid, and inhibited by internal acidification and volatile anaesthetics. [provided by RefSeq, Jul 2008]

Uniprot Description

KCNK6: Exhibits outward rectification in a physiological K(+) gradient and mild inward rectification in symmetrical K(+) conditions. Belongs to the two pore domain potassium channel (TC 1.A.1.8) family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, multi-pass; Membrane protein, integral

Chromosomal Location of Human Ortholog: 19q13.1

Cellular Component: plasma membrane; voltage-gated potassium channel complex

Molecular Function: inward rectifier potassium channel activity; potassium channel activity; potassium ion leak channel activity

Biological Process: potassium ion transport; stabilization of membrane potential

Research Articles on KCNK6

Similar Products

Product Notes

The KCNK6 kcnk6 (Catalog #AAA1275836) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcggaggg gcgcgcttct ggcgggcgcc ttggccgcgt acgccgcgta cctggtgctg ggcgcgctgt tggtggcgcg gctggagggg ccgcacgaag ccaggctccg agccgagctg gagacgctgc gggcgcagct gcttcagcgc agcccgtgtg tggctgcccc cgccctggac gccttcgtgg agcgagtgct ggcggccgga cggctggggc gggtcgtgct tgctaacgct tcggggtccg ccaacgcctc ggaccccgcc tgggacttcg cctctgctct cttcttcgcc agcacgctga tcaccaccgt gggctatggg tacacaacgc cactgactga tgcgggcaag gccttctcca tcgcctttgc gctcctgggc gtgccgacca ccatgctgct gctgaccgcc tcagcccagc gcctgtcact gctgctgact cacgtgcccc tgtcttggct gagcatgcgt tggggctggg acccccggcg ggcggcctgc tggcacttgg tggccctgtt gggggtcgta gtgaccgtct gctttctggt gccggctgtg atctttgccc acctcgagga ggcctggagc ttcttggatg ccttctactt ctgctttatc tctctgtcca ccatcggcct gggcgactac gtgcccgggg aggcccctgg ccagccctac cgggccctct acaaggtgct ggtcacagtc tacctcttcc tgggcctggt ggccatggtg ctggtgctgc agaccttccg ccacgtgtcc gacctccacg gcctcacgga gctcatcctg ctgccccctc cgtgccctgc cagtttcaat gcggatgagg acgatcgggt ggacatcctg ggcccccagc cggagtcgca ccagcaactc tctgccagct cccacaccga ctacgcttcc atccccaggt ag. It is sometimes possible for the material contained within the vial of "KCNK6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.