Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

JAGN1 cdna clone

JAGN1 cDNA Clone

Gene Names
JAGN1; SCN6; GL009
Synonyms
JAGN1; JAGN1 cDNA Clone; JAGN1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgtctcgagcaggcccgcgagcggccggcaccgacggcagcgactttcagcaccgggagcgcgtcgccatgcactaccagatgagtgtgaccctcaagtatgaaatcaagaagctgatctacgtacatctggtcatatggctgctgctggttgctaagatgagcgtgggacacctgaggctcttgtcacatgatcaggtggccatgccctatcagtgggaatacccgtatttgctgagcattttgccctctctcttgggccttctctcctttccccgcaacaacattagctacctggtgctctccatgatcagcatgggactcttttccatcgctccactcatttatggcagcatggagatgttccctgctgcacagcagctctaccgccatggcaaggcctaccgtttcctctttggtttttctgccgtttccatcatgtacctggtgttggtgttggcagtgcaagtgcatgcctggcagttgtactacagcaagaagctcctagactcttggttcaccagcacacaggagaagaagcataaatga
Sequence Length
552
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,125 Da
NCBI Official Full Name
Homo sapiens jagunal homolog 1 (Drosophila), mRNA
NCBI Official Synonym Full Names
jagunal homolog 1
NCBI Official Symbol
JAGN1
NCBI Official Synonym Symbols
SCN6; GL009
NCBI Protein Information
protein jagunal homolog 1
UniProt Protein Name
Protein jagunal homolog 1
Protein Family
UniProt Gene Name
JAGN1
UniProt Entry Name
JAGN1_HUMAN

NCBI Description

The protein encoded by this gene is a transmembrane protein. It functions in the early secretory pathway and is necessary for neutrophil differentiation and survival. Mutations in this gene result in severe congenital neutropenia. [provided by RefSeq, Oct 2014]

Uniprot Description

JAGN1: May be required for endoplasmic reticulum organization. Belongs to the jagunal family.

Protein type: Membrane protein, multi-pass; Membrane protein, integral

Chromosomal Location of Human Ortholog: 3p25.2

Cellular Component: endoplasmic reticulum

Molecular Function: protein binding

Biological Process: exocytosis; neutrophil differentiation; vesicle-mediated transport

Disease: Neutropenia, Severe Congenital, 6, Autosomal Recessive

Research Articles on JAGN1

Similar Products

Product Notes

The JAGN1 jagn1 (Catalog #AAA1273744) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgtctc gagcaggccc gcgagcggcc ggcaccgacg gcagcgactt tcagcaccgg gagcgcgtcg ccatgcacta ccagatgagt gtgaccctca agtatgaaat caagaagctg atctacgtac atctggtcat atggctgctg ctggttgcta agatgagcgt gggacacctg aggctcttgt cacatgatca ggtggccatg ccctatcagt gggaataccc gtatttgctg agcattttgc cctctctctt gggccttctc tcctttcccc gcaacaacat tagctacctg gtgctctcca tgatcagcat gggactcttt tccatcgctc cactcattta tggcagcatg gagatgttcc ctgctgcaca gcagctctac cgccatggca aggcctaccg tttcctcttt ggtttttctg ccgtttccat catgtacctg gtgttggtgt tggcagtgca agtgcatgcc tggcagttgt actacagcaa gaagctccta gactcttggt tcaccagcac acaggagaag aagcataaat ga. It is sometimes possible for the material contained within the vial of "JAGN1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.