Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ITGB8 cdna clone

ITGB8 cDNA Clone

Synonyms
ITGB8; ITGB8 cDNA Clone; ITGB8 cdna clone
Ordering
For Research Use Only!
Sequence
atgtgcggctcggccctggctttttttaccgctgcatttgtctgcctgcaaaacgaccggcgaggtcccgcctcgttcctctgggcagcctgggtgttttcacttgttcttggactgggccaaggtgaagacaatagatgtgcatcttcaaatgcagcatcctgtgccaggtgccttgcgctgggtccagaatgtggatggtgtgttcaagaggatttcatttcaggtggatcaagaagtgaacgttgtgatattgtttccaatttaataagcaaaggctgctcagttgattcaatagaatacccatctgtgcatgttataatacccactgaaaatgaaattaatacccaggtgacaccaggagaagtgtctatccagctgcgtccaggagccgaagctaattttatgctgaaagttcatcctctgaagaaatatcctgtggatctttattatcttgttgatgtctcagcatcaatgcacaataatatagaaaaattaaattccgttggaaacgatttatctagaaaaatggcatttttctcccgtgactttcgtcttggatttggctcatacgttgataaaacagtttcaccatacattagcatccaccccgaaaggattcataatcaatgcagtgactacaatttagactgcatgcctccccatggatacatccatgtgctgtctttgacagagaacatcactgagtttgagaaagcagttcatagacagaagatctctggaaacatagatacaccagaaggaggttttgacgccatgcttcaggcagctgtctgtgaaagtcatatcggatggcgaaaagaggctaaaagattgctgctggtgatgacagatcagacgtctcatctcgctcttgatagcaaattggcaggcatagtggtgcccaatgacggaaactgtcatctgaaaaacaacgtctatgtcaaatcgacaaccatggaacacccctcactaggccaactttcagagaaattaatagacaacaacattaatgtcatctttgcagttcaaggaaaacaatttcattggtataaggatcttctacccctcttgccaggcaccattgctggtgaaatagaatcaaaggctgcaaacctcaataatttggtagtggaagcctatcagaagctcatttcagaagtgaaagttcaggtggaaaaccaggtacaaggcatctattttaacattaccgccatctgtccagatgggtccagaaagccaggcatggaaggatgcagaaacgtgacgagcaatgatgaagtatgtgggtgtgcatttttcccttttaaaataaactaa
Sequence Length
1320
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
71,284 Da
NCBI Official Full Name
Homo sapiens integrin, beta 8, mRNA
NCBI Official Synonym Full Names
integrin subunit beta 8
NCBI Official Symbol
ITGB8
NCBI Protein Information
integrin beta-8
UniProt Protein Name
Integrin beta-8
Protein Family
UniProt Gene Name
ITGB8
UniProt Entry Name
ITB8_HUMAN

NCBI Description

This gene is a member of the integrin beta chain family and encodes a single-pass type I membrane protein with a VWFA domain and four cysteine-rich repeats. This protein noncovalently binds to an alpha subunit to form a heterodimeric integrin complex. In general, integrin complexes mediate cell-cell and cell-extracellular matrix interactions and this complex plays a role in human airway epithelial proliferation. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]

Uniprot Description

ITGB8: Integrin alpha-V/beta-8 is a receptor for fibronectin. Belongs to the integrin beta chain family.

Protein type: Motility/polarity/chemotaxis; Cell adhesion; Membrane protein, integral

Chromosomal Location of Human Ortholog: 7p21.1

Cellular Component: cell surface; integrin complex; plasma membrane

Biological Process: cartilage development; cell adhesion; cell-matrix adhesion; extracellular matrix organization and biogenesis

Research Articles on ITGB8

Similar Products

Product Notes

The ITGB8 itgb8 (Catalog #AAA1275629) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtgcggct cggccctggc tttttttacc gctgcatttg tctgcctgca aaacgaccgg cgaggtcccg cctcgttcct ctgggcagcc tgggtgtttt cacttgttct tggactgggc caaggtgaag acaatagatg tgcatcttca aatgcagcat cctgtgccag gtgccttgcg ctgggtccag aatgtggatg gtgtgttcaa gaggatttca tttcaggtgg atcaagaagt gaacgttgtg atattgtttc caatttaata agcaaaggct gctcagttga ttcaatagaa tacccatctg tgcatgttat aatacccact gaaaatgaaa ttaataccca ggtgacacca ggagaagtgt ctatccagct gcgtccagga gccgaagcta attttatgct gaaagttcat cctctgaaga aatatcctgt ggatctttat tatcttgttg atgtctcagc atcaatgcac aataatatag aaaaattaaa ttccgttgga aacgatttat ctagaaaaat ggcatttttc tcccgtgact ttcgtcttgg atttggctca tacgttgata aaacagtttc accatacatt agcatccacc ccgaaaggat tcataatcaa tgcagtgact acaatttaga ctgcatgcct ccccatggat acatccatgt gctgtctttg acagagaaca tcactgagtt tgagaaagca gttcatagac agaagatctc tggaaacata gatacaccag aaggaggttt tgacgccatg cttcaggcag ctgtctgtga aagtcatatc ggatggcgaa aagaggctaa aagattgctg ctggtgatga cagatcagac gtctcatctc gctcttgata gcaaattggc aggcatagtg gtgcccaatg acggaaactg tcatctgaaa aacaacgtct atgtcaaatc gacaaccatg gaacacccct cactaggcca actttcagag aaattaatag acaacaacat taatgtcatc tttgcagttc aaggaaaaca atttcattgg tataaggatc ttctacccct cttgccaggc accattgctg gtgaaataga atcaaaggct gcaaacctca ataatttggt agtggaagcc tatcagaagc tcatttcaga agtgaaagtt caggtggaaa accaggtaca aggcatctat tttaacatta ccgccatctg tccagatggg tccagaaagc caggcatgga aggatgcaga aacgtgacga gcaatgatga agtatgtggg tgtgcatttt tcccttttaa aataaactaa. It is sometimes possible for the material contained within the vial of "ITGB8, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.