ITGB3BP cdna clone

ITGB3BP

Cat. Num. AAA200910

• Gene Names: ITGB3BP; CENPR; NRIF3; TAP20; CENP-R; HSU37139
• Synonyms: ITGB3BP; CENP-R; CENPR; HSU37139; NRIF3; TAP20; ITGB3BP cdna clone

• Form/Format: Lyophilized
• Sequence: Nucleotide Sequence: ATGCCTTTTGCTCCCGTTGCCCAGGCTAGAGTGCAATGGCACGATTTCCGTTCACTGCAACATCTGCTTCCCGCGTTCAAGCGATTCTCCTGCCTCAGCCTTGGGAGTAGTTGGGATTACAGTGTTAAAAGATCACTGAAGTTGGATGGTCTGTTAGAAGAAAATTCATTTGATCCTTCAAAAATCACAAGGAAGAAAAGTGTTATAACTTATTCTCCAACAACTGGAACTTGTCAAATGAGTCTATTTGCTTCTCCCACAAGTTCTGAAGAGCAAAAGCACAGAAATGGACTATCAAATGAAAAGAGAAAAAAATTGAATCACCCCAGTTTAACTGAAAGCAAAGAATCTACAACAAAAGACAATGATGAATTCATGATGTTGCTATCAAAAGTTGAGAAATTGTCAGAAGAAATCATGGAGATAATGCAAAATTTAAGTAGTATACAGGCTTTGGAGGGCAGTAGAGAGCTTGAAAATCTCATTGGAATCTCCTGTGCATCACATTTCTTAAAAAGAGAAATGCAGAAAACCAAAGAACTAATGACAAAAGTGAATAAACAAAAACTGTTTGAAAAGAGTACAGGACTTCCTCACAAAGCATCACGTCATCTTGACAGCTATGAATTCCTTAAAGCCATTTTAAACTGA; ; Translation Sequence: MPFAPVAQAR VQWHDFRSLQ HLLPAFKRFS CLSLGSSWDY SVKRSLKLDG LLEENSFDPS KITRKKSVIT YSPTTGTCQM SLFASPTSSE EQKHRNGLSN EKRKKLNHPS LTESKESTTK DNDEFMMLLS KVEKLSEEIM EIMQNLSSIQ ALEGSRELEN LIGISCASHF LKREMQKTKE LMTKVNKQKL FEKSTGLPHK ASRHLDSYEF LKAILN
• Sequence Length: 216

• Species: Human
• Chromosome Location: 1p31.3
• OMIM Reference Number: 605494
• cDNA Size: 651bp
• Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
• Vector: (puc19-derived cloning vector)
• Preparation Before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid.
• Preparation and Storage: Store the plasmid at -20 degree C.

Related Product Information for ITGB3BP cdna clone

Centromere protein R isoform 1, also known as ITGB3BP1, is a widely expressed protein that contains a DD1 or RepD1 domain and an LXXLL motif. It acts as a transcriptional corepressor via its interaction with the NFKB1 NF-kappa-B subunit, possibly by interfering with the transactivation domain of NFKB1.

Product Categories/Family for ITGB3BP cdna clone

Epigenomics (Transcription & Translation)

NCBI and Uniprot Product Information

• NCBI GI #: 332078479
• NCBI GeneID: 23421
• NCBI Accession #: NP_001193668.1
• NCBI GenBank Nucleotide #: NM_001206739.1
• UniProt Accession #: Q13352
• NCBI Official Full Name: centromere protein R isoform 1
• NCBI Official Synonym Full Names: integrin subunit beta 3 binding protein
• NCBI Official Symbol: ITGB3BP
• NCBI Official Synonym Symbols: CENPR; NRIF3; TAP20; CENP-R; HSU37139
• NCBI Protein Information: centromere protein R
• UniProt Protein Name: Centromere protein R
• Protein Family: Centromere protein
• UniProt Gene Name: ITGB3BP
• UniProt Synonym Gene Names: CENPR; NRIF3; CENP-R
• UniProt Entry Name: CENPR_HUMAN

NCBI Description

This gene encodes a transcriptional coregulator that binds to and enhances the activity of members of the nuclear receptor families, thyroid hormone receptors and retinoid X receptors. This protein also acts as a corepressor of NF-kappaB-dependent signaling. This protein induces apoptosis in breast cancer cells through a caspase 2-mediated signaling pathway. This protein is also a component of the centromere-specific histone H3 variant nucleosome associated complex (CENP-NAC) and may be involved in mitotic progression by recruiting the histone H3 variant CENP-A to the centromere. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]

Uniprot Description

NRIF3: Transcription coregulator that can have both coactivator and corepressor functions. Isoform 1, but not other isoforms, is involved in the coactivation of nuclear receptors for retinoid X (RXRs) and thyroid hormone (TRs) in a ligand-dependent fashion. In contrast, it does not coactivate nuclear receptors for retinoic acid, vitamin D, progesterone receptor, nor glucocorticoid. Acts as a coactivator for estrogen receptor alpha. Acts as a transcriptional corepressor via its interaction with the NFKB1 NF- kappa-B subunit, possibly by interfering with the transactivation domain of NFKB1. Induces apoptosis in breast cancer cells, but not in other cancer cells, via a caspase-2 mediated pathway that involves mitochondrial membrane permeabilization but does not require other caspases. May also act as an inhibitor of cyclin A- associated kinase. Also acts a component of the CENPA-CAD (nucleosome distal) complex, a complex recruited to centromeres which is involved in assembly of kinetochore proteins, mitotic progression and chromosome segregation. May be involved in incorporation of newly synthesized CENPA into centromeres via its interaction with the CENPA-NAC complex. Homodimer; mediated by the coiled coil domain. Isoform 3, but not other isoforms, interacts with the cytoplasmic tail of integrin ITGB3. The relevance of the interaction with ITGB3 is however uncertain, since isoform 3 is mainly nuclear. Interacts with CCNA2 and MTA1. Interacts with NFKB1 NF-kappa-B subunit. Component of the CENPA-CAD complex, composed of CENPI, CENPK, CENPL, CENPO, CENPP, CENPQ, CENPR and CENPS. The CENPA-CAD complex interacts with the CENPA-NAC complex, at least composed of CENPA, CENPC, CENPH, CENPM, CENPN, CENPT and MLF1IP/CENPU. By estrogen. Widely expressed. Expressed in spleen, thymus, prostate, ovary, small intestine and white blood cells. Highly expressed in testis and colon. Isoform 4 is expressed in platelets, lymphocytes and granulocytes. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Nuclear receptor co-regulator; Transcription, coactivator/corepressor; Cell adhesion; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 1p31.3

Cellular Component: nucleoplasm; membrane; cytoplasm; nucleus; cytosol

Molecular Function: protein C-terminus binding; signal transducer activity

Biological Process: mitosis; nucleosome assembly; DNA replication-independent nucleosome assembly at centromere; nerve growth factor receptor signaling pathway; regulation of transcription, DNA-dependent; transcription, DNA-dependent; positive regulation of apoptosis; cell division; mitotic cell cycle; cell adhesion; signal transduction