Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ITGB1BP1 cdna clone

ITGB1BP1 cDNA Clone

Gene Names
ITGB1BP1; ICAP1; ICAP1A; ICAP1B; ICAP-1A; ICAP-1B; ICAP-1alpha
Synonyms
ITGB1BP1; ITGB1BP1 cDNA Clone; ITGB1BP1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtttcgcaagggcaaaaaacgacacagtagtagcagttcccaaagtagcgaaatcagtactaagagcaagtctgtggattctagccttgggggtctttcacgatccagcactgtggccagcctcgacacagattccaccaaaagctcaggacaaagcaacaataattcagatacctgtgcagaatttcgaataaaatatgttggtgccattgagaaactgaaactctccgagggaaaaggccttgaagggccattagacctgataaattatatagacgttgcccagcaagatggaaagttgccttttgttcctccggaggaagaatttattatgggagtttccaagtatggcataaaagtatcaacatcagatcaatatgatgttttgcacaggcatgctctctacttaataatccggatggtgtgttacgatgacggtctgggggtgggaaaaagcttactggctctgaagaccacagatgcaagcaatgaggaatacagcctgtgggtttatcagtgcaacagcctggaacaagcacaagccatttgcaaggttttatccaccgcttttgactctgtattaacatctgagaaaccctga
Sequence Length
603
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
16,140 Da
NCBI Official Full Name
Homo sapiens integrin beta 1 binding protein 1, mRNA
NCBI Official Synonym Full Names
integrin subunit beta 1 binding protein 1
NCBI Official Symbol
ITGB1BP1
NCBI Official Synonym Symbols
ICAP1; ICAP1A; ICAP1B; ICAP-1A; ICAP-1B; ICAP-1alpha
NCBI Protein Information
integrin beta-1-binding protein 1
UniProt Protein Name
Integrin beta-1-binding protein 1
UniProt Gene Name
ITGB1BP1
UniProt Synonym Gene Names
ICAP1; ICAP-1
UniProt Entry Name
ITBP1_HUMAN

NCBI Description

The cytoplasmic domains of integrins are essential for cell adhesion. The protein encoded by this gene binds to the beta1 integrin cytoplasmic domain. The interaction between this protein and beta1 integrin is highly specific. Two isoforms of this protein are derived from alternatively spliced transcripts. The shorter form of this protein does not interact with the beta1 integrin cytoplasmic domain. The longer form is a phosphoprotein and the extent of its phosphorylation is regulated by the cell-matrix interaction, suggesting an important role of this protein during integrin-dependent cell adhesion. Several transcript variants, some protein-coding and some non-protein coding, have been found for this gene. [provided by RefSeq, Jan 2016]

Uniprot Description

ICAP1: May play a role in the recruitment of beta-1 integrins to the focal contacts during integrin-dependent cell adhesion. Isoform 2 does not bind the integrin cytoplasmic domain-associated protein-1. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Cell adhesion; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 2p25.2

Cellular Component: cytoplasm; cytoskeleton; cytosol; focal adhesion; lamellipodium; nucleus; perinuclear region of cytoplasm; plasma membrane; ruffle

Molecular Function: GDP-dissociation inhibitor activity; integrin binding; protein binding; protein complex binding; protein transporter activity

Biological Process: activation of protein kinase B; blood vessel endothelial cell proliferation during sprouting angiogenesis; cell migration; cell-matrix adhesion; integrin activation; integrin-mediated signaling pathway; lumen formation; myoblast migration; negative regulation of cell proliferation; negative regulation of focal adhesion formation; negative regulation of protein binding; negative regulation of protein kinase activity; positive regulation of cell proliferation; positive regulation of Notch signaling pathway; positive regulation of protein kinase B signaling cascade; positive regulation of stress fiber formation; positive regulation of transcription from RNA polymerase II promoter; protein transport; receptor clustering; regulation of blood vessel size; regulation of cell adhesion mediated by integrin; regulation of GTPase activity; substrate-bound cell migration, cell release from substrate

Research Articles on ITGB1BP1

Similar Products

Product Notes

The ITGB1BP1 itgb1bp1 (Catalog #AAA1275995) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtttcgca agggcaaaaa acgacacagt agtagcagtt cccaaagtag cgaaatcagt actaagagca agtctgtgga ttctagcctt gggggtcttt cacgatccag cactgtggcc agcctcgaca cagattccac caaaagctca ggacaaagca acaataattc agatacctgt gcagaatttc gaataaaata tgttggtgcc attgagaaac tgaaactctc cgagggaaaa ggccttgaag ggccattaga cctgataaat tatatagacg ttgcccagca agatggaaag ttgccttttg ttcctccgga ggaagaattt attatgggag tttccaagta tggcataaaa gtatcaacat cagatcaata tgatgttttg cacaggcatg ctctctactt aataatccgg atggtgtgtt acgatgacgg tctgggggtg ggaaaaagct tactggctct gaagaccaca gatgcaagca atgaggaata cagcctgtgg gtttatcagt gcaacagcct ggaacaagca caagccattt gcaaggtttt atccaccgct tttgactctg tattaacatc tgagaaaccc tga. It is sometimes possible for the material contained within the vial of "ITGB1BP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.