Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IL17A cdna clone

IL17A cDNA Clone

Gene Names
IL17A; IL17; CTLA8; IL-17; CTLA-8; IL-17A
Synonyms
IL17A; IL17A cDNA Clone; IL17A cdna clone
Ordering
For Research Use Only!
Sequence
atgactcctgggaagacctcattggtgtcactgctactgctgctgagcctggaggccatagtgaaggcaggaatcacaatcccacgaaatccaggatgcccaaattctgaggacaagaacttcccccggactgtgatggtcaacctgaacatccataaccggaataccaataccaatcccaaaaggtcctcagattactacaaccgatccacctcaccttggaatctccaccgcaatgaggaccctgagagatatccctctgtgatctgggaggcaaagtgccgccacttgggctgcatcaacgctgatgggaacgtggactaccacatgaactctgtccccatccagcaagagatcctggtcctgcgcagggagcctccacactgccccaactccttccggctggagaagatactggtgtccgtgggctgcacctgtgtcaccccgattgtccaccatgtggcctaa
Sequence Length
468
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,504 Da
NCBI Official Full Name
Homo sapiens interleukin 17A, mRNA
NCBI Official Synonym Full Names
interleukin 17A
NCBI Official Symbol
IL17A
NCBI Official Synonym Symbols
IL17; CTLA8; IL-17; CTLA-8; IL-17A
NCBI Protein Information
interleukin-17A
UniProt Protein Name
Interleukin-17A
Protein Family
UniProt Gene Name
IL17A
UniProt Synonym Gene Names
CTLA8; IL17; IL-17; IL-17A; CTLA-8
UniProt Entry Name
IL17_HUMAN

NCBI Description

The protein encoded by this gene is a proinflammatory cytokine produced by activated T cells. This cytokine regulates the activities of NF-kappaB and mitogen-activated protein kinases. This cytokine can stimulate the expression of IL6 and cyclooxygenase-2 (PTGS2/COX-2), as well as enhance the production of nitric oxide (NO). High levels of this cytokine are associated with several chronic inflammatory diseases including rheumatoid arthritis, psoriasis and multiple sclerosis. [provided by RefSeq, Jul 2008]

Uniprot Description

IL17A: Induces stromal cells to produce proinflammatory and hematopoietic cytokines. Enhances the surface expression of ICAM1/intracellular adhesion molecule 1 in fibroblasts. Belongs to the IL-17 family.

Protein type: Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 6p12

Cellular Component: extracellular region

Molecular Function: hematopoietin/interferon-class (D200-domain) cytokine receptor binding; protein binding

Biological Process: apoptosis; cell death; cell surface receptor linked signal transduction; cell-cell signaling; immune response; inflammatory response; positive regulation of interleukin-23 production; positive regulation of osteoclast differentiation; positive regulation of transcription from RNA polymerase II promoter

Research Articles on IL17A

Similar Products

Product Notes

The IL17A il17a (Catalog #AAA1275382) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgactcctg ggaagacctc attggtgtca ctgctactgc tgctgagcct ggaggccata gtgaaggcag gaatcacaat cccacgaaat ccaggatgcc caaattctga ggacaagaac ttcccccgga ctgtgatggt caacctgaac atccataacc ggaataccaa taccaatccc aaaaggtcct cagattacta caaccgatcc acctcacctt ggaatctcca ccgcaatgag gaccctgaga gatatccctc tgtgatctgg gaggcaaagt gccgccactt gggctgcatc aacgctgatg ggaacgtgga ctaccacatg aactctgtcc ccatccagca agagatcctg gtcctgcgca gggagcctcc acactgcccc aactccttcc ggctggagaa gatactggtg tccgtgggct gcacctgtgt caccccgatt gtccaccatg tggcctaa. It is sometimes possible for the material contained within the vial of "IL17A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.