Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IL15 cdna clone

IL15 cDNA Clone

Gene Names
IL15; IL-15
Synonyms
IL15; IL15 cDNA Clone; IL15 cdna clone
Ordering
For Research Use Only!
Sequence
atgagaatttcgaaaccacatttgagaagtatttccatccagtgctacttgtgtttacttctaaacagtcattttctaactgaagctggcattcatgtcttcattttgggctgtttcagtgcagggcttcctaaaacagaagccaactgggtgaatgtaataagtgatttgaaaaaaattgaagatcttattcaatctatgcatattgatgctactttatatacggaaagtgatgttcaccccagttgcaaagtaacagcaatgaagtgctttctcttggagttacaagttatttcacttgagtccggagatgcaagtattcatgatacagtagaaaatctgatcatcctagcaaacaacagtttgtcttctaatgggaatgtaacagaatctggatgcaaagaatgtgaggaactggaggaaaaaaatattaaagaatttttgcagagttttgtacatattgtccaaatgttcatcaacacttcttga
Sequence Length
489
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
14,912 Da
NCBI Official Full Name
Homo sapiens interleukin 15, mRNA
NCBI Official Synonym Full Names
interleukin 15
NCBI Official Symbol
IL15
NCBI Official Synonym Symbols
IL-15
NCBI Protein Information
interleukin-15
UniProt Protein Name
Interleukin-15
Protein Family
UniProt Gene Name
IL15
UniProt Synonym Gene Names
IL-15
UniProt Entry Name
IL15_HUMAN

NCBI Description

The protein encoded by this gene is a cytokine that regulates T and natural killer cell activation and proliferation. This cytokine and interleukine 2 share many biological activities. They are found to bind common hematopoietin receptor subunits, and may compete for the same receptor, and thus negatively regulate each other's activity. The number of CD8+ memory cells is shown to be controlled by a balance between this cytokine and IL2. This cytokine induces the activation of JAK kinases, as well as the phosphorylation and activation of transcription activators STAT3, STAT5, and STAT6. Studies of the mouse counterpart suggested that this cytokine may increase the expression of apoptosis inhibitor BCL2L1/BCL-x(L), possibly through the transcription activation activity of STAT6, and thus prevent apoptosis. Alternatively spliced transcript variants of this gene have been reported. [provided by RefSeq, Feb 2011]

Uniprot Description

IL15: Cytokine that stimulates the proliferation of T- lymphocytes. Stimulation by IL-15 requires interaction of IL-15 with components of IL-2R, including IL-2R beta and probably IL-2R gamma but not IL-2R alpha. Belongs to the IL-15/IL-21 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Secreted, signal peptide; Cytokine; Cell cycle regulation; Secreted

Chromosomal Location of Human Ortholog: 4q31

Cellular Component: cytoplasm; endosome; extracellular region; Golgi apparatus; integral to plasma membrane; membrane; nucleoplasm

Molecular Function: cytokine activity; protein binding

Biological Process: cell-cell signaling; positive regulation of cell proliferation; positive regulation of inflammatory response; positive regulation of interleukin-17 production; positive regulation of tissue remodeling; signal transduction; tyrosine phosphorylation of Stat5 protein

Research Articles on IL15

Similar Products

Product Notes

The IL15 il15 (Catalog #AAA1272321) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagaattt cgaaaccaca tttgagaagt atttccatcc agtgctactt gtgtttactt ctaaacagtc attttctaac tgaagctggc attcatgtct tcattttggg ctgtttcagt gcagggcttc ctaaaacaga agccaactgg gtgaatgtaa taagtgattt gaaaaaaatt gaagatctta ttcaatctat gcatattgat gctactttat atacggaaag tgatgttcac cccagttgca aagtaacagc aatgaagtgc tttctcttgg agttacaagt tatttcactt gagtccggag atgcaagtat tcatgataca gtagaaaatc tgatcatcct agcaaacaac agtttgtctt ctaatgggaa tgtaacagaa tctggatgca aagaatgtga ggaactggag gaaaaaaata ttaaagaatt tttgcagagt tttgtacata ttgtccaaat gttcatcaac acttcttga. It is sometimes possible for the material contained within the vial of "IL15, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.