Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IL10 cdna clone

IL10 cDNA Clone

Gene Names
IL10; CSIF; TGIF; GVHDS; IL-10; IL10A
Synonyms
IL10; IL10 cDNA Clone; IL10 cdna clone
Ordering
For Research Use Only!
Sequence
ATGCACAGCTCAGCACTGCTCTGTTGCCTGGTCCTCCTGACTGGGGTGAGGGCCAGCCCAGGCCAGGGCACCCAGTCTGAGAACAGCTGCACCCACTTCCCAGGCAACCTGCCTAACATGCTTCGAGATCTCCGAGATGCCTTCAGCAGAGTGAAGACTTTCTTTCAAATGAAGGATCAGCTGGACAACTTGTTGTTAAAGGAGTCCTTGCTGGAGGACTTTAAGGGTTACCTGGGTTGCCAAGCCTTGTCTGAGATGATCCAGTTTTACCTGGAGGAGGTGATGCCCCAAGCTGAGAACCAAGACCCAGACATCAAGGCGCATGTGAACTCCCTGGGGGAGAACCTGAAGACCCTCAGGCTGAGGCTACGGCGCTGTCATCGATTTCTTCCCTGTGAAAACAAGAGCAAGGCCGTGGAGCAGGTGAAGAATGCCTTTAATAAGCTCCAAGAGAAAGGCATCTACAAAGCCATGAGTGAGTTTGACATCTTCATCAACTACATAGAAGCCTACATGACAATGAAGATACGAAACTGA
Sequence Length
537
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
20,517 Da
NCBI Official Full Name
Homo sapiens interleukin 10, mRNA
NCBI Official Synonym Full Names
interleukin 10
NCBI Official Symbol
IL10
NCBI Official Synonym Symbols
CSIF; TGIF; GVHDS; IL-10; IL10A
NCBI Protein Information
interleukin-10
UniProt Protein Name
Interleukin-10
Protein Family
UniProt Gene Name
IL10
UniProt Synonym Gene Names
IL-10; CSIF
UniProt Entry Name
IL10_HUMAN

NCBI Description

The protein encoded by this gene is a cytokine produced primarily by monocytes and to a lesser extent by lymphocytes. This cytokine has pleiotropic effects in immunoregulation and inflammation. It down-regulates the expression of Th1 cytokines, MHC class II Ags, and costimulatory molecules on macrophages. It also enhances B cell survival, proliferation, and antibody production. This cytokine can block NF-kappa B activity, and is involved in the regulation of the JAK-STAT signaling pathway. Knockout studies in mice suggested the function of this cytokine as an essential immunoregulator in the intestinal tract. Mutations in this gene are associated with an increased susceptibility to HIV-1 infection and rheumatoid arthritis.[provided by RefSeq, May 2011]

Uniprot Description

IL10: Inhibits the synthesis of a number of cytokines, including IFN-gamma, IL-2, IL-3, TNF and GM-CSF produced by activated macrophages and by helper T-cells. Belongs to the IL-10 family.

Protein type: Cytokine; Secreted; Motility/polarity/chemotaxis; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 1q31-q32

Cellular Component: extracellular space

Molecular Function: cytokine activity; interleukin-10 receptor binding; protein binding

Biological Process: cell-cell signaling; hemopoiesis; inflammatory response; leukocyte chemotaxis; negative regulation of B cell proliferation; negative regulation of cytokine secretion during immune response; negative regulation of interleukin-1 production; negative regulation of interleukin-12 production; negative regulation of interleukin-18 production; negative regulation of interleukin-6 production; negative regulation of interleukin-8 production; negative regulation of membrane protein ectodomain proteolysis; negative regulation of MHC class II biosynthetic process; negative regulation of tumor necrosis factor production; positive regulation of B cell apoptosis; positive regulation of cytokine secretion; positive regulation of JAK-STAT cascade; positive regulation of transcription factor activity; positive regulation of transcription, DNA-dependent; receptor biosynthetic process; regulation of gene expression; response to glucocorticoid stimulus; response to molecule of bacterial origin; T-helper 2 type immune response

Disease: Graft-versus-host Disease, Susceptibility To; Human Immunodeficiency Virus Type 1, Susceptibility To; Rheumatoid Arthritis

Research Articles on IL10

Similar Products

Product Notes

The IL10 il10 (Catalog #AAA1266947) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGCACAGCT CAGCACTGCT CTGTTGCCTG GTCCTCCTGA CTGGGGTGAG GGCCAGCCCA GGCCAGGGCA CCCAGTCTGA GAACAGCTGC ACCCACTTCC CAGGCAACCT GCCTAACATG CTTCGAGATC TCCGAGATGC CTTCAGCAGA GTGAAGACTT TCTTTCAAAT GAAGGATCAG CTGGACAACT TGTTGTTAAA GGAGTCCTTG CTGGAGGACT TTAAGGGTTA CCTGGGTTGC CAAGCCTTGT CTGAGATGAT CCAGTTTTAC CTGGAGGAGG TGATGCCCCA AGCTGAGAAC CAAGACCCAG ACATCAAGGC GCATGTGAAC TCCCTGGGGG AGAACCTGAA GACCCTCAGG CTGAGGCTAC GGCGCTGTCA TCGATTTCTT CCCTGTGAAA ACAAGAGCAA GGCCGTGGAG CAGGTGAAGA ATGCCTTTAA TAAGCTCCAA GAGAAAGGCA TCTACAAAGC CATGAGTGAG TTTGACATCT TCATCAACTA CATAGAAGCC TACATGACAA TGAAGATACG AAACTGA. It is sometimes possible for the material contained within the vial of "IL10, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.