Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IKZF3 cdna clone

IKZF3 cDNA Clone

Gene Names
IKZF3; AIO; AIOLOS; ZNFN1A3
Synonyms
IKZF3; IKZF3 cDNA Clone; IKZF3 cdna clone
Ordering
For Research Use Only!
Sequence
atggaagatatacaaacaaatgcggaactgaaaagcactcaggagcagtctgtgcccgcagaaagtgcagcggttttgaatgactacagtttaaccaaatctcatgaaatggaaaatgtggacagtggagaaggcccagccaatgaagatgaagacataggagatgattcaatgaaagtgaaagatgaatacagtgaaagagatgagaatgttttaaagtcagaacccatgggaaatgcagaagagcctgaaatcccttacagctattcaagagaatataatgaatatgaaaacattaagttggagagacatgttgtctcattcgatagtagcaggccaaccagtggaaagatgaactgcgatgtgtgtggattatcctgcatcagcttcaatgtcttaatggttcataagcgaagccatactggtgaacgcccattccagtgtaatcagtgtggggcatcttttactcagaaaggtaacctcctccgccacattaaactgcacacaggggaaaaaccttttaagtgtcacctctgcaactatgcatgccaaagaagagatgcgctcacggggcatcttaggacacattctgtggagaaaccctacaaatgtgagttttgtggaaggagttacaagcagagaagttcccttgaggagcacaaggagcgctgccgtacatttcttcagagcactgacccaggggacactgcaagtgcggaggcaagacacatcaaagcagagatgggaagtgaaagagctctcgtactggacagattagcaagcaatgtggcaaaacgaaaaagctcaatgcctcagaaattcattggtgagaagcgccactgctttgatgtcaactataattcaagttacatgtatgagaaagagagtgagctcatacagacccgcatgatggaccaagccatcaataacgccatcagctatcttggcgccgaagccctgcgccccttggtccagacaccgcctgctcccacctcggagatggttccagttatcagcagcatgtatcccatagccctcacccgggctgagatgtcaaacggtgcccctcaagagctggaaaagaaaagcatccaccttccagagaagagcgtgccttctgagagaggcctctctcccaacaatagtggccacgactccacggacactgacagcaaccatgaagaacgccagaatcacatctatcagcaaaatcacatggtcctgtctcgggcccgcaatgggatgccacttctgaaggaggttccccgctcttacgaactcctcaagcccccgcccatctgcccaagagactccgtcaaagtgatcaacaaggaaggggaggtgatggatgtgtatcggtgtgaccactgccgcgtcctcttcctggactatgtgatgttcacgattcacatgggctgccacggcttccgtgaccctttcgagtgtaacatgtgtggatatcgaagccatgatcggtatgagttctcgtctcacatagccagaggagaacacagagccctgctgaagtga
Sequence Length
1530
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
29,973 Da
NCBI Official Full Name
Homo sapiens IKAROS family zinc finger 3 (Aiolos), mRNA
NCBI Official Synonym Full Names
IKAROS family zinc finger 3
NCBI Official Symbol
IKZF3
NCBI Official Synonym Symbols
AIO; AIOLOS; ZNFN1A3
NCBI Protein Information
zinc finger protein Aiolos
UniProt Protein Name
Zinc finger protein Aiolos
Protein Family
UniProt Gene Name
IKZF3
UniProt Synonym Gene Names
ZNFN1A3
UniProt Entry Name
IKZF3_HUMAN

NCBI Description

This gene encodes a member of the Ikaros family of zinc-finger proteins. Three members of this protein family (Ikaros, Aiolos and Helios) are hematopoietic-specific transcription factors involved in the regulation of lymphocyte development. This gene product is a transcription factor that is important in the regulation of B lymphocyte proliferation and differentiation. Both Ikaros and Aiolos can participate in chromatin remodeling. Regulation of gene expression in B lymphocytes by Aiolos is complex as it appears to require the sequential formation of Ikaros homodimers, Ikaros/Aiolos heterodimers, and Aiolos homodimers. Several alternative transcripts encoding different isoforms have been described, as well as some non-protein coding variants. [provided by RefSeq, Apr 2012]

Uniprot Description

Aiolos: a transcription factor of the ikaros C2H2-type zinc-finger protein family. Plays an important role in the regulation of lymphocyte differentiation. Deletions in Aiolos have been observed in a subset of pre-B-cell acute lymphoblastic leukemia (B-ALL) cases. 6 isoforms of the human protein are produced by alternative splicing.

Protein type: C2H2-type zinc finger protein; DNA-binding; Transcription factor

Chromosomal Location of Human Ortholog: 17q21

Cellular Component: cytoplasm; nucleus; plasma membrane

Molecular Function: identical protein binding; protein binding; protein heterodimerization activity; protein homodimerization activity; sequence-specific DNA binding; transcription factor activity

Biological Process: mesoderm development; positive regulation of transcription from RNA polymerase II promoter; regulation of apoptosis; regulation of B cell differentiation; regulation of B cell proliferation; regulation of lymphocyte differentiation; regulation of transcription from RNA polymerase II promoter

Research Articles on IKZF3

Similar Products

Product Notes

The IKZF3 ikzf3 (Catalog #AAA1274025) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaagata tacaaacaaa tgcggaactg aaaagcactc aggagcagtc tgtgcccgca gaaagtgcag cggttttgaa tgactacagt ttaaccaaat ctcatgaaat ggaaaatgtg gacagtggag aaggcccagc caatgaagat gaagacatag gagatgattc aatgaaagtg aaagatgaat acagtgaaag agatgagaat gttttaaagt cagaacccat gggaaatgca gaagagcctg aaatccctta cagctattca agagaatata atgaatatga aaacattaag ttggagagac atgttgtctc attcgatagt agcaggccaa ccagtggaaa gatgaactgc gatgtgtgtg gattatcctg catcagcttc aatgtcttaa tggttcataa gcgaagccat actggtgaac gcccattcca gtgtaatcag tgtggggcat cttttactca gaaaggtaac ctcctccgcc acattaaact gcacacaggg gaaaaacctt ttaagtgtca cctctgcaac tatgcatgcc aaagaagaga tgcgctcacg gggcatctta ggacacattc tgtggagaaa ccctacaaat gtgagttttg tggaaggagt tacaagcaga gaagttccct tgaggagcac aaggagcgct gccgtacatt tcttcagagc actgacccag gggacactgc aagtgcggag gcaagacaca tcaaagcaga gatgggaagt gaaagagctc tcgtactgga cagattagca agcaatgtgg caaaacgaaa aagctcaatg cctcagaaat tcattggtga gaagcgccac tgctttgatg tcaactataa ttcaagttac atgtatgaga aagagagtga gctcatacag acccgcatga tggaccaagc catcaataac gccatcagct atcttggcgc cgaagccctg cgccccttgg tccagacacc gcctgctccc acctcggaga tggttccagt tatcagcagc atgtatccca tagccctcac ccgggctgag atgtcaaacg gtgcccctca agagctggaa aagaaaagca tccaccttcc agagaagagc gtgccttctg agagaggcct ctctcccaac aatagtggcc acgactccac ggacactgac agcaaccatg aagaacgcca gaatcacatc tatcagcaaa atcacatggt cctgtctcgg gcccgcaatg ggatgccact tctgaaggag gttccccgct cttacgaact cctcaagccc ccgcccatct gcccaagaga ctccgtcaaa gtgatcaaca aggaagggga ggtgatggat gtgtatcggt gtgaccactg ccgcgtcctc ttcctggact atgtgatgtt cacgattcac atgggctgcc acggcttccg tgaccctttc gagtgtaaca tgtgtggata tcgaagccat gatcggtatg agttctcgtc tcacatagcc agaggagaac acagagccct gctgaagtga. It is sometimes possible for the material contained within the vial of "IKZF3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.