IFNAR1 cdna clone

IFNAR1 cDNA Clone

Gene Names

IFNAR1; AVP; IFRC; IFNAR; IFNBR; IFN-alpha-REC

Synonyms

IFNAR1; IFNAR1 cDNA Clone; IFNAR1 cdna clone

Ordering
Cat. Num. AAA1272848 For Research Use Only!

Sequence

atgatggtcgtcctcctgggcgcgacgaccctagtgctcgtcgccgtggcgccatgggtgttgtccgcagccgcaggtggaaaaaatctaaaatctcctcaaaaagtagaggtcgacatcatagatgacaactttatcctgaggtggaacaggagcgatgagtctgtcgggaatgtgactttttcattcgattatcaaaaaactgggatggataattggataaaattgtctgggtgtcagaatattactagtaccaaatgcaacttttcttcactcaagctgaatgtttatgaagaaattaaattgcgtataagagcagaaaaagaaaacacttcttcatggtatgaggttgactcatttacaccatttcgcaaagctcagattggtcctccagaagtacatttagaagctgaagataaggcaatagtgatacacatctctcctggaacaaaagatagtgttatgtgggctttggatggtttaagctttacatatagcttagttatctggaaaaactcttcaggtgtagaagaaaggattgaaaatatttattccagacataaaatttataaactctcaccagagactacttattgtctaaaagttaaagcagcactacttacgtcatggaaaattggtgtctatagtccagtacattgtataaagaccacagttgaaaatgaactacctccaccagaaaatatagaagtcagtgtccaaaatcagaactatgttcttaaatgggattatacatatgcaaacatgacctttcaagttcagtggctccacgcctttttaaaaaggaatcctggaaaccatttgtataaatggaaacaaatacctgactgtgaaaatgtcaaaactacccagtgtgtctttcctcaaaacgttttccaaaaaggaatttaccttctccgcgtacaagcatctgatggaaataacacatctttttggtctgaagagataaagtttgatactgaaatacaagctttcctacttcctccagtctttaacattagatcccttagtgattcattccatatctatatcggtgctccaaaacagtctggaaacacgcctgtgatccaggattatccactgatttatgaaattattttttgggaaaacacttcaaatgctgagagaaaaattatcgagaaaaaaactgatgttacagttcctaatttgaaaccactgactgtatattgtgtgaaagccagagcacacaccatggatgaaaagctgaataaaagcagtgtttttagtgacgctgtatgtgagaaaacaaaaccaggaaatacctctaaaatttggcttatagttggaatttgtattgcattatttgctctcccgtttgtcatttatgctgcgaaagtcttcttgagatgcatcaattatgtcttctttccatcacttaaaccttcttccagtatagatgagtatttctctgaacagccattgaagaatcttctgctttcaacttctgaggaacaaatcgaaaaatgtttcataattgaaaatataagcacaattgctacagtagaagaaactaatcaaactgatgaagatcataaaaaatacagttcccaaactagccaagattcaggaaattattctaatgaagatgaaagcgaaagtaaaacaagtgaagaactacagcaggactttgtatga

Sequence Length

1674

Vector

pENTR223.1

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

18255501

NCBI GeneID

3454

Molecular Weight

56,046 Da

NCBI Official Full Name

Homo sapiens interferon (alpha, beta and omega) receptor 1, mRNA

NCBI Official Synonym Full Names

interferon alpha and beta receptor subunit 1

NCBI Official Symbol

IFNAR1

NCBI Official Synonym Symbols

AVP; IFRC; IFNAR; IFNBR; IFN-alpha-REC

NCBI Protein Information

interferon alpha/beta receptor 1

UniProt Protein Name

Interferon alpha/beta receptor 1

Protein Family

Interferon alpha/beta receptor

UniProt Gene Name

IFNAR1

UniProt Synonym Gene Names

IFNAR; IFN-R-1; IFN-alpha/beta receptor 1; CRF2-1

UniProt Entry Name

INAR1_HUMAN

NCBI Description

The protein encoded by this gene is a type I membrane protein that forms one of the two chains of a receptor for interferons alpha and beta. Binding and activation of the receptor stimulates Janus protein kinases, which in turn phosphorylate several proteins, including STAT1 and STAT2. The encoded protein also functions as an antiviral factor. [provided by RefSeq, Jul 2008]

Uniprot Description

IFNAR1: receptor for interferons alpha and beta. Belongs to the type II cytokine family of receptors. Binding to type I IFNs triggers tyrosine phosphorylation of a number of proteins including JAKs, TYK2, STAT proteins and IFNR alpha- and beta-subunits themselves. Tyk2 tyrosine kinase is essential for stable cell surface expression of IFNAR1. Present in all tissues and even on the surface of most IFN-resistant cells.

Protein type: Receptor, cytokine; Membrane protein, integral

Chromosomal Location of Human Ortholog: 21q22.11

Cellular Component: integral to plasma membrane; plasma membrane

Molecular Function: interferon-alpha/beta binding; interferon-alpha/beta receptor activity; protein binding

Biological Process: JAK-STAT cascade; response to lipopolysaccharide; response to virus

Research Articles on IFNAR1

1. data illustrate a lipid G-protein coupled receptor (GPCR)-IFNAR1 regulatory loop that balances effective and detrimental immune responses and elevated endogenous S1PR1 signaling

Similar Products

Product Notes

The IFNAR1 ifnar1 (Catalog #AAA1272848) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatggtcg tcctcctggg cgcgacgacc ctagtgctcg tcgccgtggc gccatgggtg ttgtccgcag ccgcaggtgg aaaaaatcta aaatctcctc aaaaagtaga ggtcgacatc atagatgaca actttatcct gaggtggaac aggagcgatg agtctgtcgg gaatgtgact ttttcattcg attatcaaaa aactgggatg gataattgga taaaattgtc tgggtgtcag aatattacta gtaccaaatg caacttttct tcactcaagc tgaatgttta tgaagaaatt aaattgcgta taagagcaga aaaagaaaac acttcttcat ggtatgaggt tgactcattt acaccatttc gcaaagctca gattggtcct ccagaagtac atttagaagc tgaagataag gcaatagtga tacacatctc tcctggaaca aaagatagtg ttatgtgggc tttggatggt ttaagcttta catatagctt agttatctgg aaaaactctt caggtgtaga agaaaggatt gaaaatattt attccagaca taaaatttat aaactctcac cagagactac ttattgtcta aaagttaaag cagcactact tacgtcatgg aaaattggtg tctatagtcc agtacattgt ataaagacca cagttgaaaa tgaactacct ccaccagaaa atatagaagt cagtgtccaa aatcagaact atgttcttaa atgggattat acatatgcaa acatgacctt tcaagttcag tggctccacg cctttttaaa aaggaatcct ggaaaccatt tgtataaatg gaaacaaata cctgactgtg aaaatgtcaa aactacccag tgtgtctttc ctcaaaacgt tttccaaaaa ggaatttacc ttctccgcgt acaagcatct gatggaaata acacatcttt ttggtctgaa gagataaagt ttgatactga aatacaagct ttcctacttc ctccagtctt taacattaga tcccttagtg attcattcca tatctatatc ggtgctccaa aacagtctgg aaacacgcct gtgatccagg attatccact gatttatgaa attatttttt gggaaaacac ttcaaatgct gagagaaaaa ttatcgagaa aaaaactgat gttacagttc ctaatttgaa accactgact gtatattgtg tgaaagccag agcacacacc atggatgaaa agctgaataa aagcagtgtt tttagtgacg ctgtatgtga gaaaacaaaa ccaggaaata cctctaaaat ttggcttata gttggaattt gtattgcatt atttgctctc ccgtttgtca tttatgctgc gaaagtcttc ttgagatgca tcaattatgt cttctttcca tcacttaaac cttcttccag tatagatgag tatttctctg aacagccatt gaagaatctt ctgctttcaa cttctgagga acaaatcgaa aaatgtttca taattgaaaa tataagcaca attgctacag tagaagaaac taatcaaact gatgaagatc ataaaaaata cagttcccaa actagccaag attcaggaaa ttattctaat gaagatgaaa gcgaaagtaa aacaagtgaa gaactacagc aggactttgt atga. It is sometimes possible for the material contained within the vial of "IFNAR1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

IFNAR1 cdna clone