IFIT2 cdna clone
IFIT2 cDNA Clone
Gene Names
IFIT2; P54; G10P2; IFI54; ISG54; cig42; IFI-54; IFIT-2; GARG-39; IFI-54K; ISG-54K; ISG-54 K
Synonyms
IFIT2; IFIT2 cDNA Clone; IFIT2 cdna clone
Sequence
atgagtgagaacaataagaattccttggagagcagcctacggcaactaaaatgccatttcacctggaacttgatggagggagaaaactccttggatgattttgaagacaaagtattttaccggactgagtttcagaatcgtgaattcaaagccacaatgtgcaacctactggcctatctaaagcacctcaaagggcaaaacgaggcagccctggaatgcttacgtaaagctgaagagttaatccagcaagagcatgctgaccaggcagaaatcagaagtctggtcacctggggaaactatgcctgggtctactatcacatgggccgactctcagacgttcagatttatgtagacaaggtgagacatgtctgtgagaagttttccagtccctatagaattgagagtccagagcttgactgtgaggaagggtggacacggttaaagtgtggaggaaaccaaaatgaaagagcgaaggtgtgctttgagaaggctctggaaaagaagccaaagaacccagaattcacctctggactggcaatagcaagctaccgtctggacaactggccaccatctcagaacgccattgaccctctgaggcaagccattcggctgaatcctgacaaccagtaccttaaagtcctcctggctctgaagcttcataagatgcgtgaagaaggtgaagaggaaggtgaaggagagaagttagttgaagaagccttggagaaagccccaggtgtaacagatgtacttcgcagtgcagccaagttttatcgaagaaaagatgagccagacaaagcgattgaactgcttaaaaaggctttagaatacataccaaacaatgcctacctgcattgccaaattgggtgctgctatagggcaaaagtcttccaagtaatgaatctaagagagaatggaatgtatgggaaaagaaagttactggaactaataggacacgctgtggctcatctgaagaaagctgatgaggccaatgataatctcttccgtgtctgttccattcttgccagcctccatgctctagcagatcagtatgaagaagcagagtattacttccaaaaggaattcagtaaagagcttactcctgtagcgaaacaactgctccatctgcggtatggcaactttcagctgtaccaaatgaagtgtgaagacaaggccatccaccactttatagagggtgtaaaaataaaccagaaatcaagggagaaagaaaagatgaaagacaaactgcaaaaaattgccaaaatgcgactttctaaaaatggagcagattctgaggctttgcatgtcttggcattccttcaggagctgaatgaaaaaatgcaacaagcagatgaagactctgagaggggtttggagtctggaagcctcatcccttcagcatcaagctggaatggggaatggagaatagagatgtggtgcccactaggctactgctga
Sequence Length
1455
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
54,632 Da
NCBI Official Full Name
Homo sapiens interferon-induced protein with tetratricopeptide repeats 2, mRNA
NCBI Official Synonym Full Names
interferon induced protein with tetratricopeptide repeats 2
NCBI Official Symbol
IFIT2
NCBI Official Synonym Symbols
P54; G10P2; IFI54; ISG54; cig42; IFI-54; IFIT-2; GARG-39; IFI-54K; ISG-54K; ISG-54 K
NCBI Protein Information
interferon-induced protein with tetratricopeptide repeats 2
UniProt Protein Name
Interferon-induced protein with tetratricopeptide repeats 2
Protein Family
UniProt Gene Name
IFIT2
UniProt Synonym Gene Names
CIG-42; G10P2; IFI54; ISG54; IFIT-2; IFI-54K; P54
UniProt Entry Name
IFIT2_HUMAN
Uniprot Description
IFIT2: IFN-induced antiviral protein which inhibits expression of viral messenger RNAs lacking 2'-O-methylation of the 5' cap. The ribose 2'-O-methylation would provide a molecular signature to distinguish between self and non-self mRNAs by the host during viral infection. Viruses evolved several ways to evade this restriction system such as encoding their own 2'-O-methylase for their mRNAs or by stealing host cap containing the 2'-O- methylation (cap snatching mechanism). Can promote apoptosis. Belongs to the IFIT family.
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 10q23.31
Cellular Component: cytoplasm; cytosol; endoplasmic reticulum
Molecular Function: protein binding; RNA binding
Biological Process: apoptotic mitochondrial changes; defense response to virus; negative regulation of protein binding; positive regulation of apoptosis; response to virus
Research Articles on IFIT2
Similar Products
Product Notes
The IFIT2 ifit2 (Catalog #AAA1265671) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagtgaga acaataagaa ttccttggag agcagcctac ggcaactaaa atgccatttc acctggaact tgatggaggg agaaaactcc ttggatgatt ttgaagacaa agtattttac cggactgagt ttcagaatcg tgaattcaaa gccacaatgt gcaacctact ggcctatcta aagcacctca aagggcaaaa cgaggcagcc ctggaatgct tacgtaaagc tgaagagtta atccagcaag agcatgctga ccaggcagaa atcagaagtc tggtcacctg gggaaactat gcctgggtct actatcacat gggccgactc tcagacgttc agatttatgt agacaaggtg agacatgtct gtgagaagtt ttccagtccc tatagaattg agagtccaga gcttgactgt gaggaagggt ggacacggtt aaagtgtgga ggaaaccaaa atgaaagagc gaaggtgtgc tttgagaagg ctctggaaaa gaagccaaag aacccagaat tcacctctgg actggcaata gcaagctacc gtctggacaa ctggccacca tctcagaacg ccattgaccc tctgaggcaa gccattcggc tgaatcctga caaccagtac cttaaagtcc tcctggctct gaagcttcat aagatgcgtg aagaaggtga agaggaaggt gaaggagaga agttagttga agaagccttg gagaaagccc caggtgtaac agatgtactt cgcagtgcag ccaagtttta tcgaagaaaa gatgagccag acaaagcgat tgaactgctt aaaaaggctt tagaatacat accaaacaat gcctacctgc attgccaaat tgggtgctgc tatagggcaa aagtcttcca agtaatgaat ctaagagaga atggaatgta tgggaaaaga aagttactgg aactaatagg acacgctgtg gctcatctga agaaagctga tgaggccaat gataatctct tccgtgtctg ttccattctt gccagcctcc atgctctagc agatcagtat gaagaagcag agtattactt ccaaaaggaa ttcagtaaag agcttactcc tgtagcgaaa caactgctcc atctgcggta tggcaacttt cagctgtacc aaatgaagtg tgaagacaag gccatccacc actttataga gggtgtaaaa ataaaccaga aatcaaggga gaaagaaaag atgaaagaca aactgcaaaa aattgccaaa atgcgacttt ctaaaaatgg agcagattct gaggctttgc atgtcttggc attccttcag gagctgaatg aaaaaatgca acaagcagat gaagactctg agaggggttt ggagtctgga agcctcatcc cttcagcatc aagctggaat ggggaatgga gaatagagat gtggtgccca ctaggctact gctga. It is sometimes possible for the material contained within the vial of "IFIT2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
