Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IDH2 cdna clone

IDH2 cDNA Clone

Gene Names
IDH2; IDH; IDP; IDHM; IDPM; ICD-M; D2HGA2; mNADP-IDH
Synonyms
IDH2; IDH2 cDNA Clone; IDH2 cdna clone
Ordering
For Research Use Only!
Sequence
atggccggctacctgcgggtcgtgcgctcgctctgcagagcctcaggctcgcggccggcctgggcgccggcggccctgacagcccccacctcgcaagagcagccgcggcgccactatgccgacaaaaggatcaaggtggcgaagcccgtggtggagatggatggtgatgagatgacccgtattatctggcagttcatcaaggagaagctcatcctgccccacgtggacatccagctaaagtattttgacctcgggctcccaaaccgtgaccagactgatgaccaggtcaccattgactctgcactggccacccagaagtacagtgtggctgtcaagtgtgccaccatcacccctgatgaggcccgtgtggaagagttcaagctgaagaagatgtggaaaagtcccaatggaactatccggaacatcctgggggggactgtcttccgggagcccatcatctgcaaaaacatcccacgcctagtccctggctggaccaagcccatcaccattggcaggcacgcccatggcgaccagtacaaggccacagactttgtggcagaccgggccggcactttcaaaatggtcttcaccccaaaagatggcagtggtgtcaaggagtgggaagtgtacaacttccccgcaggcggcgtgggcatgggcatgtacaacaccgacgagtccatctcaggttttgcgcacagctgcttccagtatgccatccagaagaaatggccgctgtacatgagcaccaagaacaccatactgaaagcctacgatgggcgtttcaaggacatcttccaggagatctttgacaagcactataagaccgacttcgacaagaataagatctggtatgagcaccggctcattgatgacatggtggctcaggtcctcaagtcttcgggtggctttgtgtgggcctgcaagaactatgacggagatgtgcagtcagacatcctggcccagggctttggctcccttggcctgatgacgtccgtcctggtctgccctgatgggaagacgattgaggctgaggccgctcatgggaccgtcacccgccactatcgggagcaccagaagggccggcccaccagcaccaaccccatcgccagcatctttgcctggacacgtggcctggagcaccgggggaagctggatgggaaccaagacctcatcaggtttgcccagatgctggagaaggtgtgcgtggagacggtggagagtggagccatgaccaaggacctggcgggctgcattcacggcctcagcaatgtgaagctgaacgagcacttcctgaacaccacggacttcctcgacaccatcaagagcaacctggacagagccctgggcaggcagtag
Sequence Length
1359
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
45,180 Da
NCBI Official Full Name
Homo sapiens isocitrate dehydrogenase 2 (NADP+), mitochondrial, mRNA
NCBI Official Synonym Full Names
isocitrate dehydrogenase (NADP(+)) 2, mitochondrial
NCBI Official Symbol
IDH2
NCBI Official Synonym Symbols
IDH; IDP; IDHM; IDPM; ICD-M; D2HGA2; mNADP-IDH
NCBI Protein Information
isocitrate dehydrogenase [NADP], mitochondrial
UniProt Protein Name
Isocitrate dehydrogenase [NADP], mitochondrial
Protein Family
UniProt Gene Name
IDH2
UniProt Synonym Gene Names
IDH
UniProt Entry Name
IDHP_HUMAN

NCBI Description

Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. Each NADP(+)-dependent isozyme is a homodimer. The protein encoded by this gene is the NADP(+)-dependent isocitrate dehydrogenase found in the mitochondria. It plays a role in intermediary metabolism and energy production. This protein may tightly associate or interact with the pyruvate dehydrogenase complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]

Uniprot Description

IDH2: a mitochondrial oxidoreductase that catalyzes the third step of the citric acid cycle: the oxidative decarboxylation of isocitrate, consuming NADP(+), and producing alpha-ketoglutarate (alpha-KG) and CO2. Can also use oxalosuccinate as a substrate. Alpha-KG is an activator the dioxygenases that hydroxylate the transcription factor HIF and lead to its degradation by VHL. Since HIF turns on oncogenic pathways, IDH2 has apparent tumor suppressor activity. Homo-dimerization is required for activity. Each subunit binds 1 magnesium or manganese ion. May tightly associate or interact with the pyruvate dehydrogenase complex. A somatic mutation resulting in the R172K conversion results in a neomorphic enzyme activity that converts isocitrate to R(-)-2-hydroxyglutarate (2HG) occurs in a significant percentage of patients with cytogenetically normal acute myeloid leukemia (AML). Elevated levels of 2HG are also correlated with an elevated risk of malignant brain tumors.

Protein type: Other Amino Acids Metabolism - glutathione; EC 1.1.1.42; Carbohydrate Metabolism - citrate (TCA) cycle; Mitochondrial; Oxidoreductase

Chromosomal Location of Human Ortholog: 15q26.1

Cellular Component: mitochondrial matrix; mitochondrion

Molecular Function: isocitrate dehydrogenase (NADP+) activity; magnesium ion binding

Biological Process: 2-oxoglutarate metabolic process; isocitrate metabolic process; tricarboxylic acid cycle

Disease: D-2-hydroxyglutaric Aciduria 2

Research Articles on IDH2

Similar Products

Product Notes

The IDH2 idh2 (Catalog #AAA1277541) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccggct acctgcgggt cgtgcgctcg ctctgcagag cctcaggctc gcggccggcc tgggcgccgg cggccctgac agcccccacc tcgcaagagc agccgcggcg ccactatgcc gacaaaagga tcaaggtggc gaagcccgtg gtggagatgg atggtgatga gatgacccgt attatctggc agttcatcaa ggagaagctc atcctgcccc acgtggacat ccagctaaag tattttgacc tcgggctccc aaaccgtgac cagactgatg accaggtcac cattgactct gcactggcca cccagaagta cagtgtggct gtcaagtgtg ccaccatcac ccctgatgag gcccgtgtgg aagagttcaa gctgaagaag atgtggaaaa gtcccaatgg aactatccgg aacatcctgg gggggactgt cttccgggag cccatcatct gcaaaaacat cccacgccta gtccctggct ggaccaagcc catcaccatt ggcaggcacg cccatggcga ccagtacaag gccacagact ttgtggcaga ccgggccggc actttcaaaa tggtcttcac cccaaaagat ggcagtggtg tcaaggagtg ggaagtgtac aacttccccg caggcggcgt gggcatgggc atgtacaaca ccgacgagtc catctcaggt tttgcgcaca gctgcttcca gtatgccatc cagaagaaat ggccgctgta catgagcacc aagaacacca tactgaaagc ctacgatggg cgtttcaagg acatcttcca ggagatcttt gacaagcact ataagaccga cttcgacaag aataagatct ggtatgagca ccggctcatt gatgacatgg tggctcaggt cctcaagtct tcgggtggct ttgtgtgggc ctgcaagaac tatgacggag atgtgcagtc agacatcctg gcccagggct ttggctccct tggcctgatg acgtccgtcc tggtctgccc tgatgggaag acgattgagg ctgaggccgc tcatgggacc gtcacccgcc actatcggga gcaccagaag ggccggccca ccagcaccaa ccccatcgcc agcatctttg cctggacacg tggcctggag caccggggga agctggatgg gaaccaagac ctcatcaggt ttgcccagat gctggagaag gtgtgcgtgg agacggtgga gagtggagcc atgaccaagg acctggcggg ctgcattcac ggcctcagca atgtgaagct gaacgagcac ttcctgaaca ccacggactt cctcgacacc atcaagagca acctggacag agccctgggc aggcagtag. It is sometimes possible for the material contained within the vial of "IDH2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.