Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ID1 cdna clone

ID1 cDNA Clone

Gene Names
ID1; ID; bHLHb24
Synonyms
ID1; ID1 cDNA Clone; ID1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaagtcgccagtggcagcaccgccaccgccgccgcgggccccagctgcgcgctgaaggccggcaagacagcgagcggtgcgggcgaggtggtgcgctgtctgtctgagcagagcgtggccatctcgcgctgcgccgggggcgccggggcgcgcctgcctgccctgctggacgagcagcaggtaaacgtgctgctctacgacatgaacggctgttactcacgcctcaaggagctggtgcccaccctgccccagaaccgcaaggtgagcaaggtggagattctccagcacgtcatcgactacatcagggaccttcagttggagctgaactcggaatccgaagttggaacccccgggggccgagggctgccggtccgggctccgctcagcaccctcaacggcgagatcagcgccctgacggccgaggcggcatgcgttcctgcggacgatcgcatcttgtgtcgctga
Sequence Length
468
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
15,586 Da
NCBI Official Full Name
Homo sapiens inhibitor of DNA binding 1, dominant negative helix-loop-helix protein, mRNA
NCBI Official Synonym Full Names
inhibitor of DNA binding 1, HLH protein
NCBI Official Symbol
ID1
NCBI Official Synonym Symbols
ID; bHLHb24
NCBI Protein Information
DNA-binding protein inhibitor ID-1
UniProt Protein Name
DNA-binding protein inhibitor ID-1
UniProt Gene Name
ID1
UniProt Synonym Gene Names
BHLHB24; ID; bHLHb24
UniProt Entry Name
ID1_HUMAN

NCBI Description

The protein encoded by this gene is a helix-loop-helix (HLH) protein that can form heterodimers with members of the basic HLH family of transcription factors. The encoded protein has no DNA binding activity and therefore can inhibit the DNA binding and transcriptional activation ability of basic HLH proteins with which it interacts. This protein may play a role in cell growth, senescence, and differentiation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

ID1: ID (inhibitor of DNA binding) HLH proteins lack a basic DNA-binding domain but are able to form heterodimers with other HLH proteins, thereby inhibiting DNA binding. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Transcription, coactivator/corepressor; DNA-binding

Chromosomal Location of Human Ortholog: 20q11

Cellular Component: Golgi apparatus; nucleoplasm; nucleus

Molecular Function: protein binding

Biological Process: angiogenesis; blood vessel endothelial cell migration; blood vessel morphogenesis; negative regulation of transcription factor activity; negative regulation of transcription, DNA-dependent; transforming growth factor beta receptor signaling pathway

Research Articles on ID1

Similar Products

Product Notes

The ID1 id1 (Catalog #AAA1272347) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaagtcg ccagtggcag caccgccacc gccgccgcgg gccccagctg cgcgctgaag gccggcaaga cagcgagcgg tgcgggcgag gtggtgcgct gtctgtctga gcagagcgtg gccatctcgc gctgcgccgg gggcgccggg gcgcgcctgc ctgccctgct ggacgagcag caggtaaacg tgctgctcta cgacatgaac ggctgttact cacgcctcaa ggagctggtg cccaccctgc cccagaaccg caaggtgagc aaggtggaga ttctccagca cgtcatcgac tacatcaggg accttcagtt ggagctgaac tcggaatccg aagttggaac ccccgggggc cgagggctgc cggtccgggc tccgctcagc accctcaacg gcgagatcag cgccctgacg gccgaggcgg catgcgttcc tgcggacgat cgcatcttgt gtcgctga. It is sometimes possible for the material contained within the vial of "ID1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.